SimpleSearch - Line and FST details


Line specific information

 
Line ID 090B05
Vector Used pAC161
Line Availability only available from NASC (N408561)
Segregation Analysis 50:46:29
Confirmed for Hit At2g30470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g30470

 
Sequence (A. th genome BLAST matches underlined)
>34-011957-strizhov-B5-8409
ATGATCCATGGTAGATTTCCCGGACATGGAAGCCTTTACAATTGAATATATCTTCAAGTG
TCGTGCATGCATTTTATGCGTTTCGTTCACTTGCATGCTCTCTCCCTCTTTCTCTCTCTA
TCTCACCCATAAAAGTTTTAATTTTTCACATCGATAAATTAAATTGAAACAAAAAAAAAA
TTTCCCCCAAAAAAAAAAACCCGGGGGGCTTTTTTTTGGGGGGGAAGGGCCTTTTTTTTT
TTTTAATTGGGGGGAAAAATTTTTTTTTTTTTTTCCCCGGGGGGGCCTTTACCAATCCTT
GGGTTTTTTTAACACAAAACCTTTGGTTTTGACCCACGGGGAGGGGGGGTAAGGAAAAGG
GGTTCCCCCCATTCGGGGGGTTGAAAAATTAAGGGGGATTTCGAAACCCATTCGGGGGTT
TTGGGGGCCCCCCCTTAGGGGGG
GenBank Accession AL769634 [GenBank]
Graphic View Graphic view of gene At2g30470
Predicted Position of Insertion Chr2:12985153 - go to primer design
BLAST e Value 7e-18
Hit Clone Code (BAC ID) T6B20
Hit Gene Code At2g30470 [TAIR] [MIPS] [SIGnAL]
Gene Annotation high-level expression of sugar-inducible gene 2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23