Sequences from confirmation amplicon


Confirmation sequences for line 091A02 and hit At2g36010 are shown.
Line ID 091A02
Locus At2g36010 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15119431
Primers used for PCR MS74 - 8474, show primer details
   
Sequence Name 31-K024136-022-091-A02C-MS74
GenBank Accession LN499993 [GenBank]
Sequencing primer gene specific primer, MS74: 5'-GCCATACATGATACAACAACCACT-3'
Sequence (A. th genome BLAST matches underlined)
>31-K024136-022-091-A02C-MS74
ATCAATACAAAAGGATAAAAAATAAAAATAAAAATATTATTACACATATCATAACGGAAA
CAGCAGCACATGTACTATAAACAAACTCTATCCCAATCTATTTGCAGAAATCTGTTTACC
GACTACACACATTTAAATAAAAATTTCAGATTCAAAAAACAAGTTCTAGATCAAAAATAT
ATATGCATGATCTCCTCTTCTTCACCATTATAAAGAACAGAAAAGAATCTCAATATTCCC
GTTACTAAAAGGCACAAAAAGTAATTTCCCTAAAGTAAGTAGGGTCAATCTAAAGGCAGG
ATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTAT
GATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGT
AGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGAT
CCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTC
GACGTGTCTACATTC
   
Sequence Name 32-K024136-022-091-A02C-8409
GenBank Accession LN500417 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>32-K024136-022-091-A02C-8409
TGATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCCTTTAG
ATTGACCCTACTTACTTTAGGGAAATTACTTTTTGTGCCTTTTAGTAACGGGAATATTGA
GATTCTTTTCTGTTCTTTATAATGGTGAAGAAGAGGAGATCATGCATATATATTTTTGAT
CTAGAACTTGTTTTTTGAATCTGAAATTTTTATTTAAATGTGTGTAGTCGGTAAACAGAT
TTCTGCAAATAGATTGGGATAGAGTTTGTTTATAGTACATGTGCTGCTGTTTCCGTTATG
ATATGTGTAATAATATTTTTATTTTTATTTTTTATCCTTTTGTATTGATTAGTGGTTGTT
GTATCAGGTATGG

Last Updated on 23.10.2014 13:25