SimpleSearch - Line and FST details


Line specific information

 
Line ID 091A02
Vector Used pAC161
Line Availability only available from NASC (N408642)
Segregation Analysis 50:49:36
Confirmed for Hit At2g36010
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g36010

 
Sequence (A. th genome BLAST matches underlined)
>09-011956-strizhov-A2-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCCTTT
AGATTGACCCTACTTACTTTAGGGAAATTACTTTTTGTGCCTTTTAGTAACGGGAATATT
GAGATTCTTTTCTGTTCTTTATAATGGTGAAGAAGAGGAGATCATGCATATATATTTTTG
ATCTATGGGATCCTCCCTATAGTGAGTCGTTATTACTCAANNGNNNNNNNNNCNNNNNNC
ANNATNTCTGCNNNTNNATNGNNATANNAGTTTGTTTATAGTACATGATGCTGCTGCTTC
CGTTATGATATGTGTAATAATATTTTTATTTTTATTCTTTATCCTTTTGTATTGATTAGC
GGTTGTTGTATCATGTATGGCAGNGGAAAAACTGATGCGAAGTGTANATTAAGTCTAAAG
TCACTTGATGAAGGATTCATAATTCAATGCAGCTTTCGGAGGACTATAATATTGCACATG
GenBank Accession AL769674 [GenBank]
Graphic View Graphic view of gene At2g36010
Predicted Position of Insertion Chr2:15119434 - go to primer design
BLAST e Value 3e-91
Hit Clone Code (BAC ID) F11F19
Hit Gene Code At2g36010 [TAIR] [MIPS] [SIGnAL]
Gene Annotation E2F transcription factor 3
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23