Sequences from confirmation amplicon


Confirmation sequences for line 091D11 and hit At4g08920 are shown.
Line ID 091D11
Locus At4g08920 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:5726286
Primers used for PCR MR42 - 8474, show primer details
   
Sequence Name 60-K016277-022-091-D11C-8409
GenBank Accession LN510123 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>60-K016277-022-091-D11C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGATCCATGTAGAGCAGAACCGGCTTCA
AACCAAGTCACTGCTATGATTCCAGAATTTAATATCAGAATTGTTGCAGAGAGCACTGAA
GACTCAACAGCGGAATCTTCCAGCAGCGGAAGGAGAGAAAGAAGCGGAGGCATAGTCCCC
GAGTGGTCTCCAGGGTACTCAGAGCAGTTCCCTAGTGAAGAAAATGGTATTGGAGGAGGA
AGTACAACGTCTAGCTACTTGCAGAATCACCATGAAATACTGAACTGGAGACGGCTTTCA
CAAACCGGGTATGTAACTCGCAAATCCGACTCTCTCAACAATAAGTTCACATAAAGATTC
TAAACATTTTCAAATTGAAAGTCTCCAAATTTTCAGTAAGTTTCAATCTTCCTACACAAT
TCAAATAAATCGTCGATGCGCGTTGTGCTTGGCACACTTGTCTAGCCAAGTAGTATCAGT
TTTAAATTGAATTTAGCTGAAAAGTTTTGAACTGTTTTCAAATCCAAGTGTTTGCATTTA
CAGTAGACCACAGTAAAAAAATTAGTGAAAGTTTCTATGTTTCACAGTTCAATTGGAATT
TGGTACATTGGTC
   
Sequence Name 64-K016277-022-091-D11C-MR42
GenBank Accession LN511097 [GenBank]
Sequencing primer gene specific primer, MR42: 5'-AAATTTCATGCCACTTGGTTAGAC-3'
Sequence (A. th genome BLAST matches underlined)
>64-K016277-022-091-D11C-mr42
TACCAAATTCCAATTGAACTGTGAAACATAGAAACTTTCACTAATTTTTTTACTGTGGTC
TACTGTAAATGCAAACACTTGGATTTGAAAACAGTTCAAAACTTTTCAGCTAAATTCAAT
TTAAAACTGATACTACTTGGCTAGACAAGTGTGCCAAGCACAACGCGCATCGACGATTTA
TTTGAATTGTGTAGGAAGATTGAAACTTACTGAAAATTTGGAGACTTTCAATTTGAAAAT
GTTTAGAATCTTTATGTGAACTTATTGTTGAGAGAGTCGGATTTGCGAGTTACATACCCG
GTTTGTGAAAGCCGTCTCCAGTTCAGTATTTCATGGTGATTCTGCAAGTAGCTAGACGTT
GTACTTCCTCCTCCAATACCATTTTCTTCACTAGGGAACTGCTCTGAGTACCCTGGAGAC
CACTCGGGGACTATGCCTCCGCTTCTTTCTCTCCTTCCGCTGCTGGAAGATTCCGCTGTT
GAGTCTTCAGTGCTCTCTGCAACAATTCTGATATTAAATTCTGGAATCATAGCAGTGACT
TGGTTTGAAGCCGGTTCTGCTCTACATGGATCAATTGTAAATGGCTTCATGTCCGGGAAA
TCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACC
AATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACAT
TTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTA
TTCTAATTCGGAAATCT

Last Updated on 23.10.2014 13:25