SimpleSearch - Line and FST details


Line specific information

 
Line ID 091D11
Vector Used pAC161
Line Availability only available from NASC (N408687)
Segregation Analysis 101:94:67
Confirmed for Hit At4g08920
Parent of DUPLO pair none
Parent of pair(s) 6779

Gene hit At4g08920

 
Sequence (A. th genome BLAST matches underlined)
>84-011956-strizhov-D11-8409
NTGATCCATGTAGATCTTCCCGGACATGAANGCCTTTACAATTGATCCATGTAGAGCAGA
ACCGGCTTCAAACCAAGTCACTGCTATGATTCCAGAATTTAATATCAGAATTGTTGCAGA
GAGCACTGAAGACTCAACAGCGGAATCTTCCAGCAGCGGAAGGAGAGAAAGAAGCGGAGG
CATAGTCCCCGAGTGGTCTCCAGGGTACTCAGAGCAGTTCCCTATGGGATCCTCCCTATA
GTGAGTCGATTTTACTC
GenBank Accession AL769700 [GenBank]
Graphic View Graphic view of gene At4g08920
Predicted Position of Insertion Chr4:5726286 - go to primer design
BLAST e Value 2e-92
Hit Clone Code (BAC ID) T3H13
Hit Gene Code At4g08920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cryptochrome 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03