Sequences from confirmation amplicon


Confirmation sequences for line 092B09 and hit At1g48230 are shown.
Line ID 092B09
Locus At1g48230 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:17806597
Primers used for PCR 54xh - 3144, show primer details
   
Sequence Name 49-K119070-0022-092-B09C-54xh
GenBank Accession LN507005 [GenBank]
Sequencing primer gene specific primer, 54xh: 5'-CAAATATTCCCATGACCTGGTAGA-3'
Sequence (A. th genome BLAST matches underlined)
>49-K119070-0022-092-B09C-54xh
ATTTCCCATAGAGGATACTACAACTCCAACACTCACCAGCACCATGTTCATGAACACGTC
ACACCTTGCTTTGTCCGTGCCACAAACAACGGCCATAAGAAATGTTGCTACCGGCACTGT
CATTCCATATTCATGTGTTAAAAAGCTTTGCAACATGATCAGAGTTCAGAAACTAATATA
GGTTTTGAGCCAAAAAAGAATTTGTGTTTTCACATACTTAGTGCTTTGAGCATCTGTATG
AAAGCAACTGAAATGTGCAAATATGCAGTATTTCCAAACCTGTAAAAAGGAGTAAAAGAA
TACTCAAGAAACAATTCAGACAGCAGGTATGACGCAATGTCAAAACTCAGAATATGAAAT
TTACAGTACTAGGAGTCCAGGACAGAGAGCATCTATAAACCTAATATGTGGCACAAGTAT
ATGGACCAAAGACTTACCAGAGACTGGATGCAAAGAATGCGCTTATAGGCACCACACATG
TCACATATCTGGAGTCCAGAAAACATGTTAAGAAAAGAAAGAGATTATGAAAAGTACAGA
TGCCAAAAAAATGAAGTAAAGAATACAGTAAGCTGGCTTACATTTCGAAAGTCATTTTAA
CAGGAGAGACAACCTACATCACAAAAAAGATACTTATTACCTACCTATTATAAGGAGTAC
TCAGCATAAGACGAGCATGTAGCATACTCCAAACAAGTGGACAAATGTAACATTCACTTA
AATGGAAGTGTAATCGCTGTACTTTGAATACCCGAATAAGAAGGAAAGCCACGAATCCCG
AAAATCCCATATGGATCATTGTCAATGTTATAGGAAAGTGAAAATTGAAGTATTTCGGAG
ATAGAACACTG
   
Sequence Name 17-K119069-0022-092-B09C-3144
GenBank Accession LN494082 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K119069-0022-092-B09C-3144
TCCTTCGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACC
CGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTCTATCTCCGAAA
TACTTCAATTTTCCACTTCCTATAACATTGACAATGATCCATATGGGATTTTCTGGATTC
GTGGCTTTCCTTCTTATTCGGGTATTCAAGGTACAGCGATTACACTTCCATTTAAGTGAA
TGTTACATTTGTCCACTTGTTTGGAGTATGCTACATGCTCGTCTTATGCTGAGTACTCCT
TATAATAGGTAGGTAATAAGTATCTTTTTTGTGATGTAGGTTGTCTCTCCTGTTAAAATG
ACTTTCGAAATGTAAGCCAGCTTACTGTATTCTTTACTTCATTTTTTTGGCATCTGTACT
TTTCATAATCTCTTTCTTTTCTTAACATGTTTTCTGGACTCCAGATATGTGACATGTGTG
GTGCCTATAAGCGCATTCTTTGCATCCAGTCTCTGGTAAGTCTTTGGTCCATATACTTGT
GCCACATATTAGGTTTATAGATGCTCTCTGTCCTGGACTCCTAGTACTGTAAATTTCATA
TTCTGAGTTTTGACATTGCGTCATACCTGCTGTCTGAATTGTTTCTTGAGTATTCTTTTA
CTCCTTTTTACAGGTTTGGAAATACTGCATATTTGCACATTTCAGTTGCTTTCATACAGA
TGCTCAAAGCACTAAGTATGTGAAAACACAAATTCTTTTTTGGCTCAAAACCTATATNAG
TTTCTGAACTCTGATCATGTTGCAAAGCTTTTTAACACATGAATATGGAATGACAGTGCC
GGTAGCAACATTTCTTATGGCCGTTGTTTGTGGCACGGACAAAGCAAGGTGTGACGTGTT
CATGAACATGGTGC

Last Updated on 07.07.2016 14:16