SimpleSearch - Line and FST details


Line specific information

 
Line ID 092B09
Vector Used pAC161
Line Availability only available from NASC (N408757)
Segregation Analysis 100:92:66
Confirmed for Hit At1g48230 At1g48220
Parent of DUPLO pair none
Parent of pair(s) 362, 4723, 4730, 4744, 4755, 4826, 5794, 5816, 10437, 83890, 83896, 83907, 83910, 83912, 83913

Gene hit At1g48230

 
Sequence (A. th genome BLAST matches underlined)
>66-012001-strizhov-B9-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTCTATCTCCGAAATACTTCAATTTTCCACTTCCTATAACATTG
ACAATGATCCATATGGGATTTTCTGGATTCGTGGCTTTCCTTCTTATTCGGGTATTCAAG
GTACAGCGATTACACTTCCATTTAAGTGAATGTTACATTTGTCCACTTGTTTGGAGTATG
CTACATGCTCGTCTTATGCTGAGTACTCCTTATAATAGGTAGGTAATAAGTATCTTTTTT
GTGATGTAGGTTGTCTCTCCTGTTAAAATGACTTTCGAAATGTAAGCCAGCTTACTGTAT
TCTTTACTTCATTTTTTTGGCATCTGTACTTTTCATAATCTCTTTCTTTTCTTAACATGT
TTTCTGGACTCCAGATATGTGACATGTGTGGTGCCTATAAGCGCATTCTTTGCATCCAGT
CTCTGGTAAGTCTTTGGTCCATATACTTGTGCCACATATTAGGTTTATAGATGCTCTCTG
TCCTGGACTCCTATGGGATCCTCCCTATAGTGAGTCGNNT
GenBank Accession BX942867 [GenBank]
Graphic View Graphic view of gene At1g48230
Predicted Position of Insertion Chr1:17806597 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11A17
Hit Gene Code At1g48230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nodulin MtN21 /EamA-like transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g48220

 
Sequence (A. th genome BLAST matches underlined)
>66-011955-strizhov-B9-8409
NTGATCCATGTAGCATTTCCCGGACATGAAGTCCTTTACATGAAGACACTGATCCTATAT
ACGGTCTAAGCTAAGGTTAGTAAAAACTGAAATGATGTACTTTAATTTTAGTATCTACCT
GGGAAAGAAATTCTTGATCTGGCTGCTTAGTAGGGTAAAGTTTCTTGATGGCAGCTTCTT
TACCGCTTTTAAGAACACCGTAAAACACTCTTCCATATGAACCTTTACCGACTAATACCT
CTGAACTAAAGTTCTCGGTTATATCTTCCAGTTCATCCACTGGAATGGCTGGTACAGCGA
TAGGCTGCATGTTAACTACTGGTTGGTTCATTGGTGGATCAGCTCTTTGATGGTGGCGTC
CATTGTAACCTTTACAACGATTCAATTCCTATTAACTTACTTAGAAGCCAAAAACTGGAC
AATATAAGAAAAACAAAGACAAGTGGTGCAGTTGAAATATGTGAGCTACCTATTGAGTTA
TGTGCTTGACTTGGTCCGGTGTCAGCAGGATTACGAACATCCTCACTCCCACACCAGCCA
AAACAGCTCATTATATTACACCCTTTTCTCACACGAGCTAACTTAACTGGTATAGTACAG
AAGACAAAATGTGACAAAAGGTATAAAAAAAGGGGTTGATAGCACCTTAAGCTTCTATCT
CCTACTTATGAAAGTGTAAGATAATATAGACCACAAACAGGTTTTGAAAAACCAGATTTG
CCCTATCTAGACAAAAGAGAAGAGAGTAAAAGGGTAGGATCAATGATCCTATCTCTTCTT
ATTACTCAGCCAATTAAATTGTCAAACACGAACAACTGAGACATTATGGTCCCTAAACCT
A
GenBank Accession AL769750 [GenBank]
Graphic View Graphic view of gene At1g48220
Predicted Position of Insertion Chr1:17803358 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F21D18
Hit Gene Code At1g48220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40