Sequences from confirmation amplicon


Confirmation sequences for line 093B01 and hit At3g55100 are shown.
Line ID 093B01
Locus At3g55100 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:20420818
Primers used for PCR MD10 - 8474, show primer details
   
Sequence Name 37-K024287-022-093-B01C-MD10
GenBank Accession LN502472 [GenBank]
Sequencing primer gene specific primer, MD10: 5'-CGAAACCGTAATCTTAGCTAAACG-3'
Sequence (A. th genome BLAST matches underlined)
>37-K024287-022-093-B01C-MD10
ATAAACTGGACCCGAACGCCCGAGCTTATCGGAACACGAGTTTTCATAGTCATGATGACC
GGTTTTCTCTTGGCTACGGTTTACTGGAAAGTAGATGACTCTCCTAGAGGCGTCCAAGAA
AGGTTAAGCTTCTTCTCCTTTGCAATGGCCACAATGTTTTACAGTTGCGCGGATGGCTTA
CCCGCTTTTATCCAAGAAAGATACATTTTCTTAAGAGAAACCGCGCATAACGCTTACCGA
AGATCTTCCTACGTTATATCTCACTCTTTAGTAACTCTGCCTCATCTCTTCGCACTTTCC
ATAGGCTTTGCAGCGACCACGTTCTGGTTCGTTGGTCTAAACGGTGGTCTGGCAGGTTTT
ATCTACTATCTTATGATCATCTTCGCGTCCTTCTGGTCAGGATGCTCGTTTGTTACATTT
GTCTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCA
ATGAGTATGATGGTCAGATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATT
TCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGAC
AAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAA
TCTTTATTTC
   
Sequence Name 38-K024287-022-093-B01C-8409
GenBank Accession LN502847 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>38-K024287-022-093-B01C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAGACAAATGTAACAA
ACGAGCATCCTGACCAGAAGGACGCGAAGATGATCATAAGATAGTAGATAAAACCTGCCA
GACCACCGTTTAGACCAACGAACCAGAACGTGGTCGCTGCAAAGCCTATGGAAAGTGCGA
AGAGATGAGGCAGAGTTACTAAAGAGTGAGATATAACGTAGGAAGATCTTCGGTAAGCGT
TATGCGCGGTTTCTCTTAAGAAAATGTATCTTTCTTGGATAAAAGCGGGTAAGCCATCCG
CGCAACTGTAAAACATTGTGGCCATTGCAAAGGAGAAGAAGCTTAACCTTTCTTGGACGC
CTCTAGGAGAGTCATCTACTTTCCAGTAAACCGTAGCCAAGAGAAAACCGGTCATCATGA
CTATGAAAACTCGTGTTCCGATAAGCTCGGGCGTTCGGGTCCAGTTTATCATGTAGCGTT
TAGCTAA

Last Updated on 23.10.2014 13:25