SimpleSearch - Line and FST details


Line specific information

 
Line ID 093B01
Vector Used pAC161
Line Availability only available from NASC (N408845)
Segregation Analysis 50:14:13
Confirmed for Hit At3g55100
Parent of DUPLO pair none
Parent of pair(s) 82996, 83002, 83007, 83012, 83013, 83014, 83015

Gene hit At3g55100

 
Sequence (A. th genome BLAST matches underlined)
>02-011954-strizhov-B1-8409
ATGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACAATTGAATATACCTGTGAACT
TTACTATGGGATCCTCCCTATGGCGAGATACGACTACTAAATGATCATAAGATAGTAGAT
AAAACCTGCCAGACCACCGTTTAGACCAACGAACCAGAACGTGGTCGCTGCAAAGCCTAT
GGAAAGTGCGAAGAGATGAGGCAGAGTTACTAAAGAGTGAGATATAACGTAGGAAGATCT
TCGGTAAGCGTTATGCGCGGTTTCTCTTAAGAAAATGTATCTTTCTTGGATAAAAGCGGG
TAAGCCATCCGCGCAACTGTAAAACATTGTGGCCATTGCAAAGGAGAAGAAGCTTAACCT
TTCTTGGACGCCTCTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession AL769827 [GenBank]
Graphic View Graphic view of gene At3g55100
Predicted Position of Insertion Chr3:20420821 - go to primer design
BLAST e Value 2e-154
Hit Clone Code (BAC ID) T15C9
Hit Gene Code At3g55100 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC-2 type transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23