Sequences from confirmation amplicon


Confirmation sequences for line 098D07 and hit At2g37170 are shown.
Line ID 098D07
Locus At2g37170 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15614682
Primers used for PCR DU05 - 8474, show primer details
   
Sequence Name 43-K021167-022-098-D07C-8409
GenBank Accession LN504691 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K021167-022-098-D07C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTATAGTTCGTAGCCACTCTCCTCTTCTTGTA
CATCACCGTTTTAACTGTCATCGGTTACAAGATTCAGTCCGACACAAAAGCCGGTGGAGT
TGACTGCGGCGGCGTCGGAATCCTTGGCATCGCGTGGGCTTTTGGTGGCATGATCTTCAT
CCTTGTCTACTGCACCGCCGGTATCTCAGGTATCATATATCGAAACCGGTCCGGTTTATT
ACCCGGTTCAGAAAATTTAACATTTGTGGACCTTTCAAATTTGTCCTTTGTTTTGTAATT
TATTTGAAATTAACCCCAAGAACTTTGTAGGTGGTCACATAAACCCTGCGGTGACGTTTG
GTTTGTTCTTAGCCCGGAAGGTATCGCTGATTAGGGCGGTGCTTTACATGGTGGCTCAGT
GTTTGGGTGCTATTTGTGGAGTTGGTTTCGTCAAAGCCTTTCAAAGCTCTTACTATGATC
GTTACGGTGGAGGAGCCAACTCTCTAGCAGACGGCTACAACACAGGCACCGGACTAGCCG
CAGAGATCATTGGAACATTCGTTCTCGTCT
   
Sequence Name 47-K021167-022-098-D07C-DU05
GenBank Accession LN506056 [GenBank]
Sequencing primer gene specific primer, DU05: 5'-GAAGACTGTGTAGACGAGAACGAA-3'
Sequence (A. th genome BLAST matches underlined)
>47-K021167-022-098-D07C-DU05
CCAATGATCTCTGCGGCTAGTCCGGTGCCTGTGTTGTAGCCGTCTGCTAGAGAGTTGGCT
CCTCCACCGTAACGATCATAGTAAGAGCTTTGAAAGGCTTTGACGAAACCAACTCCACAA
ATAGCACCCAAACACTGAGCCACCATGTAAAGCACCGCCCTAATCAGCGATACCTTCCGG
GCTAAGAACAAACCAAACGTCACCGCAGGGTTTATGTGACCACCTACAAAGTTCTTGGGG
TTAATTTCAAATAAATTACAAAACAAAGGACAAATTTGAAAGGTCCACAAATGTTAAATT
TTCTGAACCGGGTAATAAACCGGACCGGTTTCGATATATGATACCTGAGATACCGGCGGT
GCAGTAGACAAGGATGAAGATCATGCCACCAAAAGCCCACGCGATGCCAAGGATTCCGAC
GCCGCCGCAGTCAACTCCACCGGCTTTTGTGTCGGACTGAATCTTGTAACCGATGACAGT
TAAAACGGTGATGTACAAGAAGAGGAGAGTGGCTACGAACTATAAATGGCTTCATGTCCG
GGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAA
TTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAG
TACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACA
AATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACCCCC
Primers used for PCR IW28 - 3144, show primer details
   
Sequence Name 75-K119123-0022-098-D07C-IW28
GenBank Accession LN513311 [GenBank]
Sequencing primer gene specific primer, IW28: 5'-CATAAGCCTACCAAAAGGAAAACA-3'
Sequence (A. th genome BLAST matches underlined)
>75-K119123-0022-098-D07C-IW28
TCATACACGNTATACATTATTAACGTATATTGACAAGCAAAATTAATGAGAGCACTCACT
ATAGCTATAGTCTCTCTATATAAACAACTTTCATTCGTCTCTTCAGTCTTCACAAACACA
ACATATCCACAATACAAAACACAANCTTTCATATATAACAAAAAAAGTTATAGAAATGGC
CAAAGACGTGGAAGGACCTGAGGGATTTCAGACAAGAGACTACGAAGATCCGCCACCAAC
TCCGTTTTTCGATGCGGACGAGCTTACCAAGTGGTCTTTATACAGTCAAACACTGATAGT
TTAAACCGAAGGCGGGAAACGACAATCTGATCCCCGGGTACCCTGTCCTCTCCAAATGAA
ATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCC
TTACGTCAGTGGAGATATCACATCAATCCAC
   
Sequence Name 52-K119111-0022-098-D07C-35St
GenBank Accession LN507976 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>52-K119111-0022-098-D07C-35St
CTTCGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCG
GGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGACTGTATAAAGA
CCACTTGGTAAGCTCGTCCGCATCGAAAAACGGAGTTGGTGGCGGATCTTCGTAGTCTCT
TGTCTGAAATCCCTCAGGTCCTTCCACGTCTTTGGCCATTTCTATAACTTTTTTTGTTAT
ATATGAAAGTTGTGTTTTGTATTGTGGATATGTTGTGTTTGTGAAGACTGAAGAGACGAA
TGAAAGTTGTTTATATAGAGAGACTATAGCTATAGTGAGTGCTCTCATTAATTTTGCTTG
TCAATATACGTTAATAATTGTATACGTGTTATTGATTGATTATATTACGATAATGTTTTC
CTTTTGGTAGGCTTATG

Last Updated on 07.07.2016 14:16