Sequences from confirmation amplicon


Confirmation sequences for line 100A06 and hit At1g08460 are shown.
Line ID 100A06
Locus At1g08460 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:2672398
Primers used for PCR FB02 - 8474, show primer details
   
Sequence Name 12-K021167-022-100-A06C-8409
GenBank Accession LN491378 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>12-K021167-022-100-A06C-8409
GATTTCCCGGAGAAGACATTTATACCCCTTGTTATCTCAATGGTTAGAGAACACGTGTGT
TGCGCGTGAGCATCCTCCATTATTACACCACCGTTGGCCTCCGACGACGGCTCAAGCCTA
TCTTCGTCGCCGGCTTCTCCGATGGTTACCAATCGCGTAGACGTCTTCTGGCACGAAGGA
ATGCTCCGACACGACGCCGTAGAAGGCGTCTTCGACACTGGATACGACCCTGGATTCCTC
GACGTATTGGAGAAGCACCCGGAGAACGCCGATCGCGTCAGGAACATGCTTTCGATTCTC
CGACGCGGTCCCATCGCTCCTCATGTCAATTGGTTTACCGGTCTTCCAGCAATCGTTTCG
GAGCTTCTAATGTTTCACACTTCAGGTACATCGCTCTAAGGTTCGCAGAAAAGAAGGAAC
TTTTATAAAAACCTGTTTCTGAATTTGGTAGTTTTGACAAATCTTAACCTTAAAAAATTC
GACTTTGATTTGTGATTATTGCTTTCTCATGTAATCCATTGTGATCCTTGTACAGAGTAC
ATTGAGAAGCTAGTGGAGGCAGATAAAT
   
Sequence Name 16-K021167-022-100-A06C-FB02
GenBank Accession LN493242 [GenBank]
Sequencing primer gene specific primer, FB02: 5'-TGACACCGTAAGAACCTTATCAGA-3'
Sequence (A. th genome BLAST matches underlined)
>16-K021167-022-100-A06C-FB02
ATAAAACCCTTCACCTGTGCCATTTCCATAATGTACATCGATGTCAATAACCGCAACTCG
GGAACAAGAACCCGAATTCAATGCCAGCTTGACAGCAAGAGCAGCGTTGTTGAGGAAGCA
ATACCCATCAGCCTGAGTAGGCTGTGAGTGGTGACCTGGTGGGCGTACCAGAGCATATGC
AATTTTCCCATGGCAATCAAGAATATGTTGCATTGCTGAAAGAGTTGTTCCAGCTGCAAG
AAGAGCAGCTTCCCACGAGCCTGGGCTCATGAAAGTACCTGCGGCAATTTCACACCTTTC
TCCTGATTTATCTGCCTCCACTAGCTTCTCAATGTACTCTGTACAAGGATCACAATGGAT
TACATGAGAAAGCAATAATCACAAATCAAAGTCGAATTTTTTAAGGTTAAGATTTGTCAA
AACTACCAAATTCAGAAACAGGTTTTTATAAAAGTTCCTTCTTTTCTGCGAACCTTAGAG
CGATGTACCTGAAGTGTGAAAC

Last Updated on 07.07.2016 14:16