SimpleSearch - Line and FST details


Line specific information

 
Line ID 100A06
Vector Used pAC161
Line Availability only available from NASC (N409510)
Segregation Analysis 100:84:67
Confirmed for Hit At1g08460
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53830

 
Sequence (A. th genome BLAST matches underlined)
>41-012119-strizhov-A6-35St
TTGACGAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGTCCCTA
ATAATCTTTCTTTGTACTGAAAAAAAACCCACTCAAATCTCTTGGTTTACTTGATACTTC
TATGGGATCCTCCCTATAGTGAGGCGACTCACTGAGTCTCACCAACATGTCACATGTTCT
AAGATGGAAAGATCCACATATCTCTACCCTGTAGGAGACACCACATATTGAAACTGATAA
CAACTGCACACGGAGACCTGAACACAAGTCGCAGCATCTCACAAGCTATGGGATCCTACC
TATAGTGAGTCGTATCACCCAAATCGT
GenBank Accession AL755611 [GenBank]
Graphic View Graphic view of gene At3g53830
Predicted Position of Insertion Chr3:19943238 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) F5K20
Hit Gene Code At3g53830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Regulator of chromosome condensation (RCC1) family protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At1g08460

 
Sequence (A. th genome BLAST matches underlined)
>41-012073-strizhov-A6-8409
GTTAATTTCGGAGAAGAGAAATTGTCGTGCTTATTGGGCCTGGACTGAACGTGCTGTTAA
TGACATGTCGCACTGTTTTAGATTGGAGCTTTTTGGATTTCGTTATCCCACATTTAATTA
TTGGAGAACCTTTATTTTTTGACTACAAAAAAAGTATATATCGTCGGTCTCATAAAATAA
AGAAAATATAGTGGAATTTATTCATGATTCATATTCGGATAAAAAACCTTTGGGTACAAG
TATCATGTACAAAACATTCGGCTATGGGATCCTCCCTATAGTGAGCCGCTTGACTCAATC
GCTCCTCATGTCAATTGGTTTACCGGTCTTCCAGCAATCGTTTCGGAGCTTCTAATGTTT
CACACTTCAGGTACATCGCTCTAAGGTTCGCAGAAAAGAAGGAACTTTTATAAAAACCTG
TTTCTGAATTTGGTAGTTTTGACAAATCTTAACCTTAAAAAATTCGACTTTGATTTGTGA
TTATTGCTTTCTCATGTAATCCATTGTGATCCTTGTACAGAGTACATTGAGAAGCTATGG
GATCCTCCCTATAGTGAGTCG
GenBank Accession AL755610 [GenBank]
Graphic View Graphic view of gene At1g08460
Predicted Position of Insertion Chr1:2672426 - go to primer design
BLAST e Value 4e-133
Hit Clone Code (BAC ID) T27G7
Hit Gene Code At1g08460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone deacetylase 8
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03