Sequences from confirmation amplicon


Confirmation sequences for line 102H08 and hit At1g79340 are shown.
Line ID 102H08
Locus At1g79340 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29842693
Primers used for PCR VL62 - 8474, show primer details
   
Sequence Name 33-K024287-022-102-H08C-VL62
GenBank Accession LN500837 [GenBank]
Sequencing primer gene specific primer, VL62: 5'-ACAACAACATTACATCAGCAAAGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K024287-022-102-H08C-VL62
AATTCCAATGCCAGATACCAAGAATATATTCCCCTTAAAGATTCCTTAATTTCGTTTGAT
CCTAGTTTTTCTCAGCTATGACTCTATGAGAGACCAATCTCGAAAATAAGATCAACAATT
CTACAAAAAATCAAAACTTTTCCATCAAAAGATTCTTCTGATTATTATAGGATCGTCAGA
TCGTAGCCATCAATCACAAAAAAAAGAGAGAGATAAAACTCACCAGTAATCAGATTCATG
TCGCAAGGAACAATACACTCGTCGAAACCAGTGTCATCGTCTTCACCAGTCTCAGCCGGC
AACCTCGTACCGTGTCCACTGTAATGAACGACAAGAACGTCGCCGGAATCGGCAGATTCG
ACGAGATCAGCAAGCGCGCGGCGGATGTTCTTGCCAGTAGGCTGAGTAGAGGATTCATCG
GTGTCGATGAGAACGGTGATGTTCTCCTCGGAGAAGCCGTACCGTTCAACGAGACATTTG
TACATACGACGAACATCGTTGACGCATCCCCGTAACTCCGCCTTGGTTCCTGGGTAATTG
ATCCCAATAAGCACCGCCTTTTTCGTCATTGAGAAAAAATGATCTGATCGATAAAACTCT
CTGAATCTGATCGGATTATCTGTCAGCGATCCAATAGCTTCTTATTCCGACCAAAAGTGA
GATCGATCTTATATATTATATTTACTTTTGGCTAAGATTATTTCTTTATTCATTCATTTC
ATTGAATATATTCAATTGTAAATGGCTTC
   
Sequence Name 34-K024287-022-102-H08C-8409
GenBank Accession LN501259 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>34-K024287-022-102-H08C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATTCAATGAAATGAATGAATA
AAGAAATAATCTTAGCCAAAAGTAAATATAATATATAAGATCGATCTCACTTTTGGTCGG
AATAAGAAGCTATTGGATCGCTGACAGATAATCCGATCAGATTCAGAGAGTTTTATCGAT
CAGATCATTTTTTCTCAATGACGAAAAAGGCGGTGCTTATTGGGATCAATTACCCAGGAA
CCAAGGCGGAGTTACGGGGATGCGTCAACGATGTTCGTCGTATGTACAAATGTCTCGTTG
AACGGTACGGCTTCTCCGAGGAGAACATCACCGTTCTCATCGACACCGATGAATCCTCTA
CTCAGCCTACTGGCAAGAACATCCGCCGCGCGCTTGCTGATCTCGTCGAATCTGCCGATT
CCGGCGACGTTCTTGTCGTTCATTACAGTGGACACGGTACGAGGTTGCCGGCTGAGACTG
GTGAAGACGATGACACTGGTTTCGACGAGTGTATTGTTCCTTGCGACATGAATCTGATTA
CTGGTGAGTTTTATCTCTCTCTTTTTTTTGTGATTGATGGCTACGATCTGACGATCCTAT
AATAATCAGAAGAATCTTTTGATGGAAAAGTTTTGATTTTTTGTAGAATTGTTGATCTTA
TTTTCGAGATTGGTCTCTCATAGAGTCATAGCTGAGAAAAACTAGGATCAAACGAAATTA
AGGAATCTTTAAGGGGAATATATTCTTGGTATCTGACTTTGGAATTTGTCCATGGAGC
Primers used for PCR FN69 - 8474, show primer details
   
Sequence Name 13-K035333-022-102-H08C-8409
GenBank Accession LN491939 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K035333-022-102-H08C-8409
GAGCCATTTATTTCCCGAATTGGAATGTATTGTCTGACGTGGCATTGGATTTGTTTGATT
TTTTGTTTATTGTCACGTTATTGCACGACGACTAGTCACTGACTCACAAATGAGCATTAT
TATTCTTACCAAAACAAAAAAAAACGTTATTTATAAGAAAAACTAATCAGGTTTAAGCCC
AACAAGAGGCCTAATTTCGGCCCAACTTGTAAACGGAGCCGTTTAATTAACACGCCTGGG
TTTGATGCTCATTGTCATCTCCAAGACAAAA
   
Sequence Name 13-K035333-022-102-H08C-FN69
GenBank Accession LN491940 [GenBank]
Sequencing primer gene specific primer, FN69: 5'-CTTTTGTCTTGGAGATGACAATGA-3'
Sequence (A. th genome BLAST matches underlined)
>13-K035333-022-102-H08C-FN69
ATTAACGGCTCCGTTTAAAGTTGGGCCGAAATTAGGCCTCTTGTTGGGCTTAAACCTGAT
TAGTTTTTCTTATAAATAACGTTTTTTTTTGTTTTGGTAAGAATAATAATGCTCATTTGT
GAGTCAGTGACTAGTCGTCGTGCAATAACGTGACAATAAACAAAAAATCAAACAAATCCA
ATGCCACGTCAGACAATACATTCCAATTCGTGGAAATAAATGGCTTCATGTCCGGGAAAT
CTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCA
ATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATT
TTGATAAAACGACAAATTAC

Last Updated on 23.10.2014 13:25