SimpleSearch - Line and FST details


Line specific information

 
Line ID 102H08
Vector Used pAC161
Line Availability only available from NASC (N409788)
Segregation Analysis 50:45:42
Confirmed for Hit At1g79340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g14720

 
Sequence (A. th genome BLAST matches underlined)
>64-K012501-022-102-H08-35St
GACAAACTGACGTAAGAGAACCACACACTTTCCCCTATACCATCGCAGACCCTTCCTCTA
TATAAGGAATTTCATTTCATTTGGAGAGGACAGGGCACCCGGGGATCAGATTGTCGTTTC
CCGCCTTCGGTTTAAACTATCACATTGTCATACCTGCATTTGTGATATATATTCAATTGT
AAATGGCTTCATGTCCGGTAAAACTACATGGATCATCAATGAGTATGATGGTCAATATGG
AAAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCCAAAATGTAAATGTCCGCATCG
TTATTATAAAATGAAAGTACACTTTTGATAAAACGACAAATCACGATCCGTCGTATTTAT
ACGCGAAAGCAATAAACATATCATTCTAATTCGGAAATCTTTATTTCTACGTGCCTACAT
TCACGTCCAAATGGGGGCTTACATGAGAAACTTCACGATCGATGCCTTGATTTCGCCATT
CCCAGATACCCATTTAATCTTCAGATTGGGCTGATATTATGCGAAAATATGCACTCATAT
ACCTAAATACTGACAGCTCGAGCTACCAATTCAGTGTGGCCCATTACCTTACATAATTCA
CTCAAATGCTATGGGATCCTCCCTATATAACTNNNNNNNNNCNNNNNNGAAAAAANNNGG
GGAACCCCTTTAACCCCCGTAAATGATTGAGTCTCAAAAAGCAGTGGAGACATGCTTTTN
AAGGAAAACACAACTGGGGGAATTTTGGATTTAAAAAAAACCACAAATTTCCCTTTCCAG
GCCCNAAAAGGAGAAAATTGCAGAGAATTTGGGGTGCCTTTATATCTCCTATTGGGGTGT
AAATTTGGTTTGACAGGTTTATATTTAGGGGACAACTACTACAGTGATTTTCTTATTATG
GGGGGAAAATTTTCCCCACCTTTCTTTTGTACTTA
GenBank Accession FR803033 [GenBank]
Graphic View Graphic view of gene At5g14720
Predicted Position of Insertion Chr5:4748767 - go to primer design
BLAST e Value 3e-14
Hit Clone Code (BAC ID) T15N1
Hit Gene Code At5g14720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At1g79340

 
Sequence (A. th genome BLAST matches underlined)
>64-K012380-022-102-H08-8409
TATAGACGACCATAATAACCTATACTCAGCCTACTGGCAAGAACATCCGCCGCGCGCTTG
CTGATCTCGTCGAATCTGCCGATTCCGGCGACGTTCTTGTCGTTCATTACAGTGGACACG
GTACGAGGTTGCCGGCTGAGACTGGTGAAGACGATGACACTGGTTTCGACGAGTGTATTG
TTCCTTGCGACATGAATCTGATTACTGGNGAGTTTTATCTCTCTCTTTTTTTTGGGATTG
ATGGCTACGATCTGACGATCCTATAATAATCAGAAGAATCTTTTGAGGGAAAAGTTTTGA
TTTTTTTGGAAATTTGGTGATCTTATTTTCGAGATTGGTCTCTCATAAAGTCATAGCTGA
GAAAA
GenBank Accession AL755855 [GenBank]
Graphic View Graphic view of gene At1g79340
Predicted Position of Insertion Chr1:29842692 - go to primer design
BLAST e Value 4e-146
Hit Clone Code (BAC ID) YUP8H12R
Hit Gene Code At1g79340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation metacaspase 4
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968733 [GenBank]


Last Updated on 07.07.2016 14:03