Sequences from confirmation amplicon


Confirmation sequences for line 103G03 and hit At1g60040 are shown.
Line ID 103G03
Locus At1g60040 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:22119644
Primers used for PCR MK01 - 8474, show primer details
   
Sequence Name 78-K118152-0022-103-G03C-MK01
GenBank Accession LN513743 [GenBank]
Sequencing primer gene specific primer, MK01: 5'-CATGAGAGGATCGCTAAATGTATG-3'
Sequence (A. th genome BLAST matches underlined)
>78-K118152-0022-103-G03C-MK01
CACTCCGATCCCAACATGATCATCACAAAAATTCCCTAGATTGTAAGTTTGGTAAAGTTC
TGCCGCCGCCTCCTGAAGATAATTACCGCCGAAAGTGCCAAGATGATCCATTCCCGTGTA
AGCTGCATCTTTTGATTCGTAATTGGAAACATTCTCGTTCAAATTCCTTGACCCGCGGAC
CACGTAAGCCAACTCGTCAAATACATCACACGAACCCAGCTTCTTATCTGAAACCCTAAT
TAGATGATCTTCTGACAATATATCCGTCAAATTAGGCTCTATCTTCAACTTGTGATCGGA
GATGGCCGAGTTCTCTGAAACCCTTGCACCATCTTTTTCGGAAGAACCCGTGAGCGTCTT
CTTAAGAATTTCTATCTTTTGTTCCCTGACTCCAAGTAATTGAGAGTCAAGGTGAAGGAG
ATGCTTCCTTAACTCCTCACGAGACAAACCCTTGAGATGATGAGGGAAGTCATTCAATTG
TAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATG
GAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAAAGTAGATGTCCGC
   
Sequence Name 30-K118151-0022-103-G03C-8409
GenBank Accession LN499907 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>30-K118151-0022-103-G03C-8409
TCATTGAATGACTTCCCTCATCATCTCAAGGGTTTGTCTCGTGAGGAGTTAAGGAAGCAT
CTCCTTCACCTTGACTCTCAATTACTTGGAGTCAGGGAACAAAAGATAGAAATTCTTAAG
AAGACGCTCACGGGTTCTTCCGAAAAAGATGGTGCAAGGGTTTCAGAGAACTCGGCCATC
TCCGATCACAAGTTGAAGATAGAGCCTAATTTGACGGATATATTGTCAGAAGATCATCTA
ATTAGGGTTTCAGATAAGAAGCTGGGTTCGTGTGATGTATTTGACGAGTTGGCTTACGTG
GTCCGCGGGTCAAGGAATTTGAACGAGAATGTTTCCAATTACGAATCAAAAGATGCAGCT
TACACGGGAATGGATCATCTTGGCACTTTCGGCGGTAATTATCTTCAGGAGGCGGCGGCA
GAACTTTACCAAACTTACAATCTAGGGAATTTTTGTGATGATCATGTTTGGGATCTGGAG
TTTGCCTCAAGACTACCACCACTTCATACATTTAGCGTCCCTCTCATG

Last Updated on 07.07.2016 14:16