SimpleSearch - Line and FST details


Line specific information

 
Line ID 103G03
Vector Used pAC161
Line Availability only available from NASC (N409867)
Segregation Analysis 100:74:64
Confirmed for Hit At1g60040
Parent of DUPLO pair none
Parent of pair(s) 11857

Gene hit At1g60040

 
Sequence (A. th genome BLAST matches underlined)
>23-K012379-022-103-G03-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATGACTTCCCTCATC
ATCTCAAGGGTTTGTCTCGTGAGGAGATAAGGAAGCATCTCCTTCACCTTGACTCTAATT
ACTTGGAGTCCGGGAACAAAAGATGGAAATTCTTACGAAGACGCTCACGGGTTCTTCCGA
AAAAGATGGTGCAAGGGTTTCAGAGAACTCGGCCATCTCCGATCACAAGTTGAAGATAGA
GCCTAATTTGACGGATATATTGTCAGAAGATCATCTAATTAGGGTTTCAGATAAGAAGCT
GGGTTCGGGAGATGTATTTGACGAGATGGCTTACGTGGTCCGCGGGTCAAGGAATTTGAA
CGAGAATGTTTCCAATTACGAGTCAAAAGATGCAGCTTACACGGGAATGGATCATCTTGG
CACTTTCGGCGTGTATTATCTTCAGGAGGCGGCGGCTGAACTTTACCAAACTTACAATCT
ATGGGATCCTCCCTATGATGA
GenBank Accession AL755943 [GenBank]
Graphic View Graphic view of gene At1g60040
Predicted Position of Insertion Chr1:22119644 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2K10
Hit Gene Code At1g60040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 49
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40