Sequences from confirmation amplicon


Confirmation sequences for line 104F01 and hit At2g21530 are shown.
Line ID 104F01
Locus At2g21530 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:9219414
Primers used for PCR ZC03 - 8474, show primer details
   
Sequence Name 05-K023372-022-104-F01C-8409
GenBank Accession LN488179 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K023372-022-104-F01C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATATCATCATCATCATCATCATC
ATCACTTTTCTGTTTCTATGGAAACAGTAATAGAAACAACCTAAATGGAGCTGTTTCAGT
AAACTGCTTGAGAGAGAATGAGCAGATCAGTAATATTAGCTTCATTGCGAAGAAACCAAG
AAGTCATGCACCGGTGGTGAGAACAACACGCGCCTCCTTGGATGAGAATCAATCCCCAAC
TTCCGGAGGAGAACGGTGGCTTCTCAAACCAGTTGGTCAGAGGCTATTTTTTTGTTTCTC
TAGGTTTAATATCAATGAGCTTCTTTAATCTTTTTGAGTCTTGAAAGTCTTTTTGCCTGA
AAACTTATAGGCGATGGAGACACAAGACACATTGGTTACAAAGTGGCAATGCCTGCTCCT
TTTGAGATCTCCTCTGTAAGAAACTATACATTCCACTAGATTGATTGATTTTGATGAGTT
TTTAGTTTTTGCTAAGATCACAAAAATGGGTATTGAGCAGGGCCAAGTTACCATCGGACG
GCTACCGGAAAAGGCTGACGTCGTGATTCCTGTTGCCACCGGTATTTCTCTGTTCTTGTG
GTTTTCGGTTTTCTTGAATTTGTAATCAAAGTGAATTTGGTTTTAATATGAATCAATTTG
ATATAGTTT
   
Sequence Name 06-K023372-022-104-F01C-ZC03
GenBank Accession LN488627 [GenBank]
Sequencing primer gene specific primer, ZC03: 5'-AAACCCGAAACCAAAACTATATCA-3'
Sequence (A. th genome BLAST matches underlined)
>06-K023372-022-104-F01C-ZC03
ACCAAATTCACTTTGATTACAAATTCAAGAAAACCGAAAACCACAAGAACAGAGAAATAC
CGGTGGCAACAGGAATCACGACGTCAGCCTTTTCCGGTAGCCGTCCGATGGTAACTTGGC
CCTGCTCAATACCCATTTTTGTGATCTTAGCAAAAACTAAAAACTCATCAAAATCAATCA
ATCTAGTGGAATGTATAGTTTCTTACAGAGGAGATCTCAAAAGGAGCAGGCATTGCCACT
TTGTAACCAATGTGTCTTGTGTCTCCATCGCCTATAAGTTTTCAGGCAAAAAGACTTTCA
AGACTCAAAAAGATTAAAGAAGCTCATTGATATTAAACCTAGAGAAACAAAAAAATAGCC
TCTGACCAACTGGTTTGAGAAGCCACCGTTCTCCTCCGGAAGTTGGGGATTGATTCTCAT
CCAAGGAGGCGCGTGTTGTTCTCACCACCGGTGCATGACTTCTTGGTTTCTTCGCAATGA
AGCTAATATTACTGATCTGCTCATTCTCTCTCAAGCAGTTTACTGAAACAGCTCCATTTA
GGTTGTTTCTATTACTGTTTCCATAGAAACAGAAAAGTGATGATGATGATGATGATGATG
ATATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGT
ATGAATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAA
TGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTAC
GATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAA

Last Updated on 23.10.2014 13:25