SimpleSearch - Line and FST details


Line specific information

 
Line ID 104F01
Vector Used pAC161
Line Availability only available from NASC (N409949)
Segregation Analysis 100:92:70
Confirmed for Hit At2g21530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g21530

 
Sequence (A. th genome BLAST matches underlined)
>06-K018336-022-104-F01-8409
TTTCCCGGACTGAAGCATTTACATTGAATATATATCATCATCATCATCATCATCATCACT
TTTCTGTTTCTATGGAAACAGTAATAGAAACAACCTAAATGGAGCTGTTTCAGTAAACTG
CTTGAGAGAGAATGAGCAGATCAGTAATATTAGCTTCATTGCGAAGAAACCAAGAAGTCA
TGCACCGGTGGTGAGAACAACACGCGCCTCCTTGGATGAGAATCAATCCCCAACTTCCGG
AGGAGAACGGTGGCTTCTCAAACCAGTTGGTCAGAGGCTATTTTTTTGTTTCTCTATGGG
ATCTCCCCCTAATAGTGAGANNANNANAANCNNCNNTCCCTNTTTTTTTTTCTTCCAACA
AATAGTTTCAGAGGCATCTTATATAATGGAAGTATCTTCTTGGTAAAGAAGACATTAATA
AGCCCCGCCTTTATTTGCGAGAAGAATCACAACATAATTCCTGATAGGTAATCTTTGTTT
TCCGAAGAGGATTTCCGGCTTCACCGAGGGGGGTAAAAAAAGAAATACCCTTTGGACTGC
TGCGACTGCACCCTTGAAAAGGGNGGANTANAAAAGCGTGTCGGGCTCCACCATGTTGAC
GAACATTTTTCTCTTGTCATTGAGTCGTAAAAGACTCTGTATGGACTGTTCGCCAGTCTT
TACGGCGAGTTCTGTTAAGGTCCTCTATTTGAATCTTTGACTCCATGGGAAATTGGGGAT
CCGCTA
GenBank Accession BX001172 [GenBank]
Graphic View Graphic view of gene At2g21530
Predicted Position of Insertion Chr2:9219428 - go to primer design
BLAST e Value 2e-122
Hit Clone Code (BAC ID) F3K23
Hit Gene Code At2g21530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SMAD/FHA domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX001173 [GenBank]


Last Updated on 31.08.2016 09:40