Sequences from confirmation amplicon


Confirmation sequences for line 106C03 and hit At1g30070 are shown.
Line ID 106C03
Locus At1g30070 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:10547202
Primers used for PCR FS06 - 8474, show primer details
   
Sequence Name 07-K021056-022-106-C03C-8409
GenBank Accession LN489065 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K021056-022-106-C03C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATTCAACAATTGCTGATCCAT
CATATTTATGTCGTTTTATCACTATGGTCAAGTCTTCCAGAGGAAACTGGCTTGACATTC
ACCACAAAGAAGACAAGGTAAAAAACTAAAACTCAAGAACACCATGCTTTAGCTTTTGTC
TGGTGAACTTATAGCTAATGATCAAGTACTGTTTGTTGTTTGTTCAGATTAAACCGAGTT
TGGAGAAAGAGAAAGACCCAATGGCTGGAATTATGGGGATGATGAAGGTAAAAGGATCTC
TTAATTCTTGAGTCTGAGAAACATGTTAGTGCATTTCGCATTGGTTGCTTATGGTGTCTT
TTCTTTTGTCTTGA
   
Sequence Name 08-K021056-022-106-C03C-FS06
GenBank Accession LN489533 [GenBank]
Sequencing primer gene specific primer, FS06: 5'-AGTTCTGCAGTGTCAAGACAAAAG-3'
Sequence (A. th genome BLAST matches underlined)
>08-K021056-022-106-C03C-FS06
ACCATAAGCAACCAATGCGAAATGCACTAACATGTTTCTCAGACTCAAGAATTAAGAGAT
CCTTTTACCTTCATCATCCCCATAATTCCAGCCATTGGGTCTTTCTCTTTCTCCAAACTC
GGTTTAATCTGAACAAACAACAAACAGTACTTGATCATTAGCTATAAGTTCACCAGACAA
AAGCTAAAGCATGGTGTTCTTGAGTTTTAGTTTTTTACCTTGTCTTCTTTGTGGTGAATG
TCAAGCCAGTTTCCTCTGGAAGACTTGACCATAGTGATAAAACGACATAAATATGATGGA
TCAGCAATTGTTGAATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGA
TCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTT
CAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAA
CGACAAATTACGATCCGTCGTATTTATGGGCGAAAGCAATAAACAAATTATTCTAATTCG
GAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16