SimpleSearch - Line and FST details


Line specific information

 
Line ID 106C03
Vector Used pAC161
Line Availability only available from NASC (N410107)
Segregation Analysis 100:50:33
Confirmed for Hit At1g30070
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g30070

 
Sequence (A. th genome BLAST matches underlined)
>19-K012378-022-106-C03-8409
NTGATCCATTGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATTCAACAATT
GCTGATCCATCATATTTATGTCGTTTTATCACTATGGTCAAGTCTTCCAGAGGAAACTGG
CTTGACATTCACCACAAAGAAGACAAGGTAAAAAACTAAAACTCAAGAACACCATGCTTT
AGCTTTTGTCTGGTGAACTTATAGCTAATGATCAAGTACTGTTTGTTGTTTGTTCAGATT
AAACCGAGTTTGGAGAAAGAGAAAGACCCAATGGCTGGAATTATGGGGATGATGAAGGTA
AAAGGATCTCTTAATTCTTGAGTCTGAGAAACATGTTAGTGCATTTCGCATTGGTTGCTT
ATGGTGTCTTTTCTTTTGTCTTGACACTGCAGAACTTGTATGAGGATGGAGATGAAGAAA
TGACGAAGACAATATGTCAAGCCTGGACAGATGCTATGGGATCCTCACTATGGTGAGTGA
GTTTAACTCAGGAACCTTTGGGTTCGCATTTGAACTGACTGCAGAGTCTCTCAGCTACAG
CAAGAAGATTCATGCTTAATTAAAATCAAAAGGTAGGCCTTCTTTACCCTCAATCCAGGA
AATAAGTTATAATAATTTTTAGCCCCAGAACTCAAAGGTATCA
GenBank Accession AL756168 [GenBank]
Graphic View Graphic view of gene At1g30070
Predicted Position of Insertion Chr1:10547229 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T1P2
Hit Gene Code At1g30070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SGS domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03