Sequences from confirmation amplicon


Confirmation sequences for line 107F02 and hit At4g28840 are shown.
Line ID 107F02
Locus At4g28840 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:14241209
Primers used for PCR DC06 - 8474, show primer details
   
Sequence Name 43-K017716-022-107-F02C-DC06
GenBank Accession LN504673 [GenBank]
Sequencing primer gene specific primer, DC06: 5'-TGTATGTGTATGTGTGTGTGGGAA-3'
Sequence (A. th genome BLAST matches underlined)
>43-K017716-022-107-F02C-DC06
TCTAATGACATCTGGACACAATCTGATCCAGCGAGGCAGTAGTTACTGATCTTAATAACA
AAACATAAAAAAGATTTTTAAAAAAAAAATCCTTTTTTAAAAAGATAAAATAAAAAAGCT
TATAAAGAAGAGATCACCATTAGAGATCTCTTCGATTCCTCAGCTCAAAGCTAGCCAAAC
CAACCCCACACACACAAAACGAAAAAAAAACAATTGGTGGGTTTTTTCTCTCTCTAGCAA
GATTTTCTCTCTCTAGTTCTTTGATTATTAGTATTTTTTCCGGGGTATAAACCAAGAAAT
GGGTAGTAGTTTTTTCGGGAGACCAAAAATGGGGGGATCTTCGTCATCATCACCAACATC
TTCTTCTTCTTCTCCGGCAAAGAGAGGGAAGAACAAGAATGGTTCTGACAAGCCTAAGCA
GCCTCAGAGAGGTCTCGGCGTCGCGCAGTTAGAGAAGATTAGATTACACGGCGAGTATAA
CTGCAACAGCTTCAATACCTACCCTTCTTATCATCCCTCAACTTATCAGGTACAAATTTC
ACTCACATATACATATCTCTATAGATCCATGTAAAAATAGTCTAGTAGTAATTGTTTTTT
ATAAATTTTAGAATTTCATCAAAAAAACTCTGGTTTAGAATGGCTTCATGTAAATGTAGA
AATACATTTTAGATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAG
CAATGAGTATG
   
Sequence Name 44-K017716-022-107-F02C-8409
GenBank Accession LN505029 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>44-K017716-022-107-F02C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATCTAAAATGTATTTCTACA
TTTACATGAAGCCATTCTAAACCAGAGTTTTTTTGATGAAATTCTAAAATTTATAAAAAA
CAATTACTACTAGACTATTTTTACATGGATCTATAGAGATATGTATATGTGAGTGAAATT
TGTACCTGATAAGTTGAGGGATGATAAGAAGGGTAGGTATTGAAGCTGTTGCAGTTATAC
TCGCCGTGTAATCTAATCTTCTCTAACTGCGCGACGCCGAGACCTCTCTGAGGCTGCTTA
GGCTTGTCAGAACCATTCTTGTTCTTCCCTCTCTTTGCCGGAGAAGAAGAAGAAGATGTT
GGTGATGATGACGAAGATCCACCCATTTTTGGTCTCCCGAAAAAACTACTACCCATTTCT
TGGTTTATACACCGGAAAAAATACTAATAATCAAAGAACTAGAGAGAGAAAATCTTGCTA
GAGAGAGAAAAAACCCAACAATTGTTTTTTTTTCGTTTTGTGTGTGTGGGGTTGGTTTGG
CTAGCTTTGAGCTGAGGAATCGAAGAGATCTCTAATGGTGATCTCTTCTTTATAAGCTTT
TTTATTTTATCTTTTTAAAAAAGGATTTTTTTTTTAAAAATCTTTTTTATGTTTTGTTAT
AAAGATCAGTAACTACTGCCTCGCTGGATCAGATTGTGTCCAGATTTCATTAGATACTTC
CC

Last Updated on 07.07.2016 14:16