SimpleSearch - Line and FST details


Line specific information

 
Line ID 107F02
Vector Used pAC161
Line Availability only available from NASC (N410238)
Segregation Analysis 100:96:80
Confirmed for Hit At4g28840
Parent of DUPLO pair none
Parent of pair(s) 11787

Gene hit At4g28840

 
Sequence (A. th genome BLAST matches underlined)
>14-K012377-022-107-F02-8409
NACTTGTTCCATGTAGATTCTCCCTGTCATGAANGCCTTTACAATCTGAATATCTAAAAT
GTATTTCTACATTTACATGAAGCCATTCTAAACCAGAGTTTTTTTGATGAAATTCTAAAA
TTTATAAAAAACAATTACTACTATGGGATCCTCACTAGGATGAAGTACGGTATATGCATA
TGTGAGTGAAATTTGTACCTGATAAGTTGAGGGATGATAAGAAGGGTAGGTATTGAAGCT
GTTGCAGTTATACTCGCCGTGTAATCTAATCTTCTCTAACTGCGCGACGCCGAGACCTCT
CTGAGGCTGCTTAGGCTTGTCAGAACCATTCTTGTTCTTCCCTCTCTTTGCCGGAGAAGA
AGAAGAAGATGTTGGTGATGATGACGAAGATCCACCCATTTTTGGTCTCCCGAAAAAACT
ACTACCCATTTCTTGGTTTATACACCGGAAAAAATACTAATAATCAAAGAACTATAGAGA
GAAAATCTTGCTATGGATCCTTCCCCTATAGGGAGTCGTTTT
GenBank Accession BX890753 [GenBank]
Graphic View Graphic view of gene At4g28840
Predicted Position of Insertion Chr4:14241237 - go to primer design
BLAST e Value 4e-177
Hit Clone Code (BAC ID) F16A16
Hit Gene Code At4g28840 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890754 [GenBank]


Last Updated on 14.10.2014 10:23