Sequences from confirmation amplicon


Confirmation sequences for line 108G02 and hit At1g62180 are shown.
Line ID 108G02
Locus At1g62180 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:22976433
Primers used for PCR MS07 - 8474, show primer details
   
Sequence Name 28-K016674-022-108-G02C-8409
GenBank Accession LN498630 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K016674-022-108-G02C-8409
GTAGATTTCCCGGACATGAAGCCATTGCTGATCCATTGGCGGTGTTGGAAGTCTTGTGAA
GTGGAATCCTTTGGCTAATGTTGAAGGAGCTGATGTGTGGAACTTTCTGAGAACTATGGA
TGTTCCGGTGAATGCATTGCACGCACAAGGGTATGTGTCAATCGGGTGTGAGCCGTGTAC
TAGGCCGGTGCTTCCAGGCCAACATGAGAGAGAAGGAAGGTGGTGGTGGGAAGATGCTAA
AGCTAAAGAATGTGGTCTACACAAAGGGAACATCAAGGAGGAAGATGGTGCTGCAGACTC
AAAGCCTGCTGCTGTGCAAGAGATATTTGAAAGCAACAATGTGGTTGCATTGAGCAAAGG
AGGGGTTGAGAATCTTTTGAAGCTAGAGAACCGTAAAGAGGCGTGGTTGGTCGTACTTTA
CGCTCCTTGGTGCCCTTTCTGCCAGGCGATGGAAGCATCGTACATCGAATTGGCTGAGAA
ACTTGCGGGAAAAGGAGTTAAAGTGGCGAAATTCCGAGCTGACGGTGAGCAGAAGGAGTT
TGCTAAGCAAGAGCT
   
Sequence Name 32-K016674-022-108-G02C-MS07
GenBank Accession LN500368 [GenBank]
Sequencing primer gene specific primer, MS07: 5'-CTCCCTAACTGAAGCTCTTGCTTA-3'
Sequence (A. th genome BLAST matches underlined)
>32-K016674-022-108-G02C-ms07
ACTCCTTCTGCTCACCGTCAGCTCGGAATTTCGCCACTTTAACTCCTTTTCCCGCAAGTT
TCTCAGCCAATTCGATGTACGATGCTTCCATCGCCTGGCAGAAAGGGCACCAAGGAGCGT
AAAGTACGACCAACCACGCCTCTTTACGGTTCTCTAGCTTCAAAAGATTCTCAACCCCTC
CTTTGCTCAATGCAACCACATTGTTGCTTTCAAATATCTCTTGCACAGCAGCAGGCTTTG
AGTCTGCAGCACCATCTTCCTCCTTGATGTTCCCTTTGTGTAGACCACATTCTTTAGCTT
TAGCATCTTCCCACCACCACCTTCCTTCTCTCTCATGTTGGCCTGGAAGCACCGGCCTAG
TACACGGCTCACACCCGATTGACACATACCCTTGTGCGTGCAATGCATTCACCGGAACAT
CCATAGTTCTCAGAAAGTTCCACACATCAGCTCCTTCAACATTAGCCAAAGGATTCCACT
TCACAAGACTTCCAACACCGCCAATGGATCAGCAATGGCTTCATGTCCGGGAAATCTACA
TGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTT
TTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGAT
AAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTA

Last Updated on 07.07.2016 14:16