SimpleSearch - Line and FST details


Line specific information

 
Line ID 108G02
Vector Used pAC161
Line Availability only available from NASC (N410346)
Segregation Analysis 95:95:75
Confirmed for Hit At1g62180
Parent of DUPLO pair none
Parent of pair(s) 1599, 3015

Gene hit At1g62180

 
Sequence (A. th genome BLAST matches underlined)
>15-K012313-022-108-G02-8409
NTGATCCATGTAGATTTCCCGGACATGAAGCACTTGCTGATCCATTGGCGGTGTTGGAAG
TCTTGTGAAGTGGAATCCTTTGGCTAATGTTGAAGGAGCTGATGTGTGGAACTTTCTGAG
AACTATGGATGTTCCGGTGAATGCATTGCACGCACAAGGGTATGTGTCAATCGGGTGTGA
GCCGTGTACTATGGGATCCTCCCTATAGTGAGTCTATTTTACT
GenBank Accession BX649696 [GenBank]
Graphic View Graphic view of gene At1g62180
Predicted Position of Insertion Chr1:22976433 - go to primer design
BLAST e Value 7e-77
Hit Clone Code (BAC ID) F19K23
Hit Gene Code At1g62180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 5'adenylylphosphosulfate reductase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40