Sequences from confirmation amplicon


Confirmation sequences for line 110C11 and hit At1g20620 are shown.
Line ID 110C11
Locus At1g20620 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:7144070
Primers used for PCR ZC01 - 8474, show primer details
   
Sequence Name 13-K023372-022-110-C11C-8409
GenBank Accession LN491856 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K023372-022-110-C11C-8409
ATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATCCCGTCAAAAAATTA
GGGCTTTTTATCAAATCAATCAGTTGGTAGTAAAATTTTGTGGATTGTTCTTGTCGATTC
CGTTTGATTGTTGACCAAATTTCTTCCTGGATTTTGTTGATAATCGATCGTATAATGGTG
ATTGCAGTATCGTCCTTCAAGCGCGTACAACGCCCCATTCTACACCACAAACGGTGGTGC
TCCAGTCTCCAACAACATCTCTTCCCTCACCATCGGAGAAAGAGGTATCGTAACCCTGAA
TTTCAAGAGTCTATCAATAAGAATCGGAACTTGTTGGATTTATGAAAGAGATAAAACTGA
GATATAGAGTCTAAGCTGAGATCTTGTTCGTGAAGCGTGATGTGATTATTTTTAACATGT
GTTACTTCGTAATGGGCAGGTCCGGTTCTTCTTGAGGATTATCATTTGATCGAGAAGGTT
GCTAATTTCACCAGAGAGAGGATCCCTGAGAGAGTGGTTCATGCTAGAGGAATCAGTGCT
AAGGGTTTCTTTGAAGTCACCCATGACATTTCAAACCTCACTTGTGCTGATTTTCTCAGA
GCCCCTGGTGTTCAAACTCCGGTTATTGTCCGTTTCTCCACCGTTGTCCACGAACGTGCC
AGTCCTGAAACCATG
   
Sequence Name 14-K023372-022-110-C11C-ZC01
GenBank Accession LN492325 [GenBank]
Sequencing primer gene specific primer, ZC01: 5'-TGTAAAACTTGACAGCAAAACCAC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K023372-022-110-C11C-ZC01
CGAATATCCCTCATGGTTTCAGGACTGGCACGTTCGTGGACAACGGTGGAGAAACGGACA
ATAACCGGAGTTTGAACACCAGGGGCTCTGAGAAAATCAGCACAAGTGAGGTTTGAAATG
TCATGGGTGACTTCAAAGAAACCCTTAGCACTGATTCCTCTAGCATGAACCACTCTCTCA
GGGATCCTCTCTCTGGTGAAATTAGCAACCTTCTCGATCAAATGATAATCCTCAAGAAGA
ACCGGACCTGCCCATTACGAAGTAACACATGTTAAAAATAATCACATCACGCTTCACGAA
CAAGATCTCAGCTTAGACTCTATATCTCAGTTTTATCTCTTTCATAAATCCAACAAGTTC
CGATTCTTATTGATAGACTCTTGAAATTCAGGGTTACGATACCTCTTTCTCCGATGGTGA
GGGAAGAGATGTTGTTGGAGACTGGAGCACCACCGTTTGTGGTGTAGAATGGGGCGTTGT
ACGCGCTTGAAGGACGATACTGCAATCACCATTATACGATCGATTATCAACAAAATCCAG
GAAGAAATTTGGTCAACAATCAAACGGAATCGACAAGAACAATCCACAAAATTTTACTAC
CAACTGATTGATTTGATAAAAAGCCCTAATTTTTTGACGGGATATTCAATTGTAAATGGC
TTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGTGTTAATATGGAGAAAA
AGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATG

Last Updated on 07.07.2016 14:16