SimpleSearch - Line and FST details


Line specific information

 
Line ID 110C11
Vector Used pAC161
Line Availability only available from NASC (N410499)
Segregation Analysis 100:96:77
Confirmed for Hit At1g20620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g20620

 
Sequence (A. th genome BLAST matches underlined)
>83-K012311-022-110-C11-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATTTCCTATGAGAAA
AGAGCGTCTATTATAAATAATCGGATATTTAAAAGGGCGTGAAAAGGTTTATCCGTTCGT
CATTCGTATGGGCATGCCAACCACAGGGTTCCTCGCTCGGGAGTGCTTGGCATTCCGTGC
GATGATGATCTTCTGTTCAACCACCCAAACGTGGGAAAGCCTGACTACTAGACCAGCATT
CCAAAAAGATCCCTTGGCTCGTCTGGGTCGGCTATGGGATCCTCCCTATAATGAGTCGTT
TCACTCAATTTCAAGAGTCTATCAATAAGAATCGGAACTTGTTGGATTTATGAAAGAGAT
AAAACTGAGATATAGAGTCTAAGCTGAGATCTTGTTCGTGAAGCGTGATGTGATTATTTT
TAACATGTGTTACTTCGTAATGGGCAGGTCCGGTTCTTCTTGAGGATTATCATTTGATCG
AAAANGTTGCTAATTTCACCAAAGAGAGGATCCCTGAGAGAAGGGGTCATGCTTTGGGAT
CCTCCCTATTAGGAGTCGGATTACTCAA
GenBank Accession AL756533 [GenBank]
Graphic View Graphic view of gene At1g20620
Predicted Position of Insertion Chr1:7144318 - go to primer design
BLAST e Value 1e-111
Hit Clone Code (BAC ID) F5M15
Hit Gene Code At1g20620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation catalase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR934546 [GenBank]

Gene hit At4g16110

 
Sequence (A. th genome BLAST matches underlined)
>83-K012332-022-110-C11-35St
CTGCGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGTCTTTT
TCTCTTACTCTTTTTGCAGGATGTCTTCATCGCTAATGGCTCTATGTCCGGGAAATCTAC
ATGGATCAGCAATGATGATGATGGTCAGTATGGAGAAAAATAAAGAGTCTGTACCATGTG
TTTTTCACTTCAAAAATGTAGATGGACGCAGCGTTATTATAGAAACGAAAGTGCATTTTG
ATAATACGACCAATTACTAGCCGTCGTATATATACGCGAAAGCCATAAACAAATTATTCT
AATTCGGAAATCTCTATATCCACGTGTCTACATTCACGTCGCAAGGGGGGCTTAGATGAG
AAACTTGACGATCGATGCCTTGATTTGGCCATTCCCACATACCCATTTCATCTTGAGATT
GGTCTGATATTATGCGAAAATATACACTCATATACATAAATACTGACAGTTTGAGCTACC
AATTCAATGGAGCCCATTACCTTACATAATTTACTCAAATGCTATGGGATCCTCCCTATA
GTGAGCGTNATAACCCTCACGACTTTGGGAATCCTCCCTATAGGGAGTCGTTTTAC
GenBank Accession FR803238 [GenBank]
Graphic View Graphic view of gene At4g16110
Predicted Position of Insertion Chr4:9115425 - go to primer design
BLAST e Value 0.088
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation response regulator 2
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit FR803239 [GenBank]


Last Updated on 31.08.2016 09:40