Sequences from confirmation amplicon


Confirmation sequences for line 110E12 and hit At5g11200 are shown.
Line ID 110E12
Locus At5g11200 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:3569152
Primers used for PCR PP09 - 8474, show primer details
   
Sequence Name 22-K102867-0022-110-E12C-8409
GenBank Accession LN496068 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K102867-0022-110-E12C-8409
TGTTTCTGAGAACGAGACTGTGAGTGTGAGACTCTTTAGCTTTGGTATGGTTTCTATCGG
TGATCATAGCATTATTTGAGCATCTTCTGTTGTTCTGCCCTGGAAAAGTTGCAACTGATC
TCTGGAAGGATCTCAACCTAATAATGCTTTGGGTAGTTTGTAGGGGTTGAGAACTCTGAG
TGGAGACTCTGTAGCTTTGGTATGATTGAGTGACCGTTGCACAACAGGATTTCCTTTCAT
CTTAACCTTTTATTCAGTTTCAATTTCTTTGAAAATCTAGCAGTGGTGGGTGGGTTTTGG
GTCGGGGTACTGTGTTTTCCCAAGGTTTCATCGTGCTCGTATGGGTCTCAATGTTCCGAG
CAATATTGATGTTTCATAGCAAAACTCACATCTTTGAAGAGAAAAGGTGGA
   
Sequence Name 22-K102868-0022-110-E12C-PP09
GenBank Accession LN496069 [GenBank]
Sequencing primer gene specific primer, PP09: 5'-TCCACCTTTTCTCTTCAAAGATGT-3'
Sequence (A. th genome BLAST matches underlined)
>22-K102868-0022-110-E12C-PP09
CATATTGCTCGGACATTGAGACCCATACGAGCACGATGAAACCTTGGGAAAACACAGTAC
CCCGACCCAAAACCCACCCACCACTGCTAGATTTTCAAAGAAATTGAAACTGAATAAAAG
GTTAAGATGAAAGGAAATCCTGTTGTGCAACGGTCACTCAATCATACCAAAGCTACAGAG
TCTCCACTCAGAGTTCTCAACCCCTACAAACTACCCAAAGCATTATTAGGTTGAGATCCT
TCCAGAGATCAGTTGCAACTTTTCCAGGGCAGAACAACAGAAGATGCTCAAATAATGCTA
TGATCACCGATAGAAACCATACCAAAGCTAAAGAGTCTCACACTCACAGTCTCGTTCTCT
AGAAACTACCCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATG
GAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGC
GTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTAT
AGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACAT
TCACGTCCAAATGG

Last Updated on 23.10.2014 13:25