SimpleSearch - Line and FST details


Line specific information

 
Line ID 110E12
Vector Used pAC161
Line Availability only available from NASC (N410524)
Segregation Analysis 50:10:10
Confirmed for Hit At5g11200
Parent of DUPLO pair none
Parent of pair(s) 11658

Gene hit At4g26970

 
Sequence (A. th genome BLAST matches underlined)
>93-K012311-022-110-E12-8409
NTGATCCATGTAGATTTCCCGGACATGGGTCCTATCTATGGGATCCTCTCCTCATGGATG
AGATCCCCTTCCTCAAGATCGGCTTCAGCTTTTCTAGGGCAGAGCCGCAGACGATGCTCA
TATTATGCTACTGATCACCCGTAGAAGGCTCCGAATCGATGAAAGCTATGGCATCCTCCC
TATAGTGACTGGTACTACCACTTTTCTCTAACCAGCCACTCTATTCACTTTTGCTCCCCA
GAAACTGCTGTAAACTGATTGAACTTGACCACAGTAGAGAAAAGAGGCATGCATTCTTAG
AAATCCACTCATCTTCCTCCTATATTTTCTTTGTCATACATTTTATGAAGAGAATCCATA
TTGTTAACTCTTGTGCAAAGATCTGGTAGCCTTTGATGCAAAAACCATTGCTTTGGCTTC
GTCGCTTGACATCATCCAATCCCTCTCAGCACGACGTTGACGTTGCCTTGCATTCTTTGC
ACGTTTAGGGGCCATTCTTGCATCTCTCTCTGCCAATGCTATGGGATCCTCCCTATAGTG
AGTCG
GenBank Accession AL756557 [GenBank]
Graphic View Graphic view of gene At4g26970
Predicted Position of Insertion Chr4:13548508 - go to primer design
BLAST e Value 4e-180
Hit Clone Code (BAC ID) F10M23
Hit Gene Code At4g26970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aconitase 2
Insertion Classification TS2TE (3')
Confirmation Status unknown
Other FSTs Supporting this Hit AL756557 [GenBank]

Gene hit At5g11200

 
Sequence (A. th genome BLAST matches underlined)
>93-K030270-022-110-E12-8409
AACTGTGACTGTGAGACTCTTTAGCTTTGGTACTGGTTTCTATCAGTGATCATACCATTA
TTTGAGCATCTTCTGTTGTTCTGCCCTGGAAAAGTTGCAACTGATCTCTGGAAGGATCTC
AACCTAATAATGCTTTGGGTAGTTTGTAGGGGTTGACAACTCTGAGTGGATACTCTGTAA
CTGTGGTATGATTGAGTGACCAGTTGCACAGCAAGATTTCCTTTCTGCTTAGCATTTTAG
ATCCTTTCTATTTCTTTGAAGAATCTTCCCTTGGTAGGTTGGGTAAAGACAANTTGAAGT
GTTGANGGGTAANTTTATTCAGGGAGGAATGTATTCATGGTGTAAGAAAGCAGAATGACA
ACTGAGCGGAGGAGTTAATCGAAGGTAGGCAGGAATGCGAAGACTGACAATAGTGAAAGA
TAGAAAAGAAAGGGCATGAGAAAATAGCAAGGAAAAAAAAAACAACGGAGACAGGAAGAA
AAACAAGAAGACGAATGAG
GenBank Accession CR934571 [GenBank]
Graphic View Graphic view of gene At5g11200
Predicted Position of Insertion Chr5:3569168 - go to primer design
BLAST e Value 1e-92
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DEAD/DEAH box RNA helicase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR934570 [GenBank]


Last Updated on 31.08.2016 09:40