Sequences from confirmation amplicon


Confirmation sequences for line 111B03 and hit At3g22950 are shown.
Line ID 111B03
Locus At3g22950 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:8137406
Primers used for PCR JU07 - 8474, show primer details
   
Sequence Name 28-K019778-022-111-B03C-8409
GenBank Accession LN498650 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K019778-022-111-B03C-8409
CCATTGAATTGAATATATTCTAATGGTTCCCGGACATTTTTGCCATTTTTATAAAGCGTC
GTCGTTTTACCAGCATTATCCAAACCAACAACAACAATCTTATACTCTTTTGCAGGAAAC
ATCATGAACCAAAACCTCGACATGAATGCTCCCATCTCCTCCAATTTCTATCACAAACAA
GATCCTAATCAAATAAAACACATCATTACTTTTACGATCAAATTGTTCTACAAACAGAGT
GAAATCGAGAAACCCTAAAGATACATCCTTTAAATTGACCCATCAATTTTACAAACCCAA
GTAATTGAATCAGAGAAGCCCAGATCAGATTTGGATACAACGATCCCAGATTCGATAAAG
TTAACCAAATCTAAATTATATATATACAAATCGGGAAATTTGTGATCAAACCTTGAATCA
GCTAGAATCTGAAGATTGCAGAGGTAAGAATCGGAGATCAAAAAAAGTTCTTCTTCTACT
ATTTTGTAAGCTTTTGAGGTTCCTTCCTTAAAGCAGATGGGTGGAGAGAAGAAGAAGAAG
AAAAGTATGCGGGAAACAATGTCAAAACTGTAAATATGATGATCTAAATTATTAATAACT
TTTAATATAACAAATATTAAAATGAAAACTATATAGTAATGTTTTCTTTTACTTACCCAA
ACGGCTGCAGCCTCTACCGTAATGGCACCGAACACGTCACCGCC

Last Updated on 23.10.2014 13:25