SimpleSearch - Line and FST details


Line specific information

 
Line ID 111B03
Vector Used pAC161
Line Availability only available from NASC (N410575)
Segregation Analysis 100:91:85
Confirmed for Hit At3g22950
Parent of DUPLO pair none
Parent of pair(s) 5872, 7672, 7673, 88816, 88817, 88818, 88819, 88820, 88821, 88822, 88823

Gene hit At3g22950

 
Sequence (A. th genome BLAST matches underlined)
>18-K012310-022-111-B03-8409
NTGATCCATGTAGATTTCCCGAACATGAAGTCCTTTACAATATGAACTATATTCCTAGCT
CGTACTCTTTCTCTACATTCATTGTGAATATACTGTGGGAAACCTTAAAAACGACCTTGT
TCGTTTTTGGTCAGACCTTTCAAAATGAACATGGACTTATGGAACACGCCTATTTTTGTC
ATGATCTACCGTGAGACCCAAGGGATCCTCGCTATACGGGGGCGTATCTACTTACGACCG
GGTTGTTCTCCATGCAGAGCGACCTATAGAGACCCTATAGCATCCATTCTTTAGATCGAC
CCATCAGTCTATACAGACCCAGGGAATTGAATCCGAGACGCCCAGAGCATACTTGGATAC
AGCGATCCCAAATTCGATGAAGCCAACCAAATCTAAAGTATATATATACAAATCGGGAAA
TTTGTGATCAAACCTTGAATCAGCTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession AL756608 [GenBank]
Graphic View Graphic view of gene At3g22950
Predicted Position of Insertion Chr3:8137395 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) F5N5
Hit Gene Code At3g22950 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ADP-ribosylation factor C1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23