SimpleSearch - Line and FST details


Line specific information

 
Line ID 111B03
Vector Used pAC161
Line Availability only available from NASC (N410575)
Segregation Analysis 100:91:85
Confirmed for Hit At3g22950
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g22950

 
Sequence (A. th genome BLAST matches underlined)
>18-K012310-022-111-B03-8409
NTGATCCATGTAGATTTCCCGAACATGAAGTCCTTTACAATATGAACTATATTCCTAGCT
CGTACTCTTTCTCTACATTCATTGTGAATATACTGTGGGAAACCTTAAAAACGACCTTGT
TCGTTTTTGGTCAGACCTTTCAAAATGAACATGGACTTATGGAACACGCCTATTTTTGTC
ATGATCTACCGTGAGACCCAAGGGATCCTCGCTATACGGGGGCGTATCTACTTACGACCG
GGTTGTTCTCCATGCAGAGCGACCTATAGAGACCCTATAGCATCCATTCTTTAGATCGAC
CCATCAGTCTATACAGACCCAGGGAATTGAATCCGAGACGCCCAGAGCATACTTGGATAC
AGCGATCCCAAATTCGATGAAGCCAACCAAATCTAAAGTATATATATACAAATCGGGAAA
TTTGTGATCAAACCTTGAATCAGCTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession AL756608 [GenBank]
Graphic View Graphic view of gene At3g22950
Predicted Position of Insertion Chr3:8137395 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) F5N5
Hit Gene Code At3g22950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ADP-ribosylation factor C1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40