Sequences from confirmation amplicon


Confirmation sequences for line 111H04 and hit At1g21500 are shown.
Line ID 111H04
Locus At1g21500 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:7530460
Primers used for PCR DE28 - 8474, show primer details
   
Sequence Name 27-K025674-022-111-H04C-8409
GenBank Accession LN498224 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K025674-022-111-H04C-8409
GTAGATTTCCCGGACATGAAGCCATTTACTGATATAATTGGTTATTTTAAAAACAACTAT
TTTTTTTCCAAATTCGATCAGACCGGTTGGACCGGATCAACCTCACATCCACTTTGACTC
CGGTTTTTGCTTTTAGTACCGTGATCGTTGTAAGATTCCTAAACAAAATCATAAATGGAA
GAATCTCTATGCAGGACAATTTTGGTGGGGCTAGGCGGTGCGCTATGGAGTTGGAACGCT
CTGGCCGCTAAGGAGGAGGCAATGGCGGCAGCAAGACGGCCGCCTCCACCACCACCTAAG
GAGAAGAAAGACCCGACCGTGACCGGAGTTCAGGCCAAGGTATTGGCGAGTAAGAAGCGT
AAAGAAG
   
Sequence Name 28-K025674-022-111-H04C-DE28
GenBank Accession LN498691 [GenBank]
Sequencing primer gene specific primer, DE28: 5'-TTCTTCTTTACGCTTCTTACTCGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K025674-022-111-H04C-DE28
GCCTGAACTCCGGTCACGGTCGGGTCTTTCTTCTCCTTAGGTGGTGGTGGAGGCGGCCGT
CTTGCTGCCGCCATTGCCTCCTCCTTAGCGGCCAGAGCGTTCCAACTCCATAGCGCACCG
CCTAGCCCCACCAAAATTGTCCTGCATAGAGATTCTTCCATTTATGATTTTGTTTAGGAA
TCTTACAACGATCACGGTACTAAAAGCAAAAACCGGAGTCAAAGTGGATGTGAGGTTGAT
CCGGTCCAACCGGTCTGATCGAATTTGGAAAAAAAATAGTTGTTTTTAAAATAACCAATT
ATATCAGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGT
CAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGT
CCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCG
TATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTG
TCTACATTCACG

Last Updated on 07.07.2016 14:16