SimpleSearch - Line and FST details


Line specific information

 
Line ID 111H04
Vector Used pAC161
Line Availability only available from NASC (N410648)
Segregation Analysis 50:46:39
Confirmed for Hit At1g21500
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g21500

 
Sequence (A. th genome BLAST matches underlined)
>32-K012310-022-111-H04-8409
NTGATCCATGTAGATTTCCCGGACTGAAGCACTTTACTGTTGACCTGTGTGCCTGATTAG
AAACTCTATTTCTTTTCCAACTCTATCCTACCGGCTGGACCGGATCAACCTCCACATCCA
CTTTGACTCCGGATTTTAGCTTTTAGGACCCGTGAACGACAGCAACATTCCTATACCACC
TCTAATGGGACGAATCTCTATGCAGGACAATTTTGCTGGGGCTAAGCGATCCCCCCTGTA
GATGGAACACCACGTCCCTACCGAGGAGGCAGTGGCGGTGGCAATACCGTCGTCTCCACC
ACCACCTAAGGAGAAGAAAGACCCGACCGCGACCGGAGGTCAGGCCAAGGTATTGGCGAG
TAAGAAGCGTAAAGAAGAAATGAAGGCTTCCATTGCTAAACTTAGAGAGAAAGGCAAACC
TGTTGTTGAAGCAAAACCATCCTCTTCTTCTTCAGAATAGCATCCGAGCAACAATTTAAA
CCCTTTCCATTAATTCATCTGTCTACCAAATTCATCCCTATGATGTTAATTCACTACTAT
ATTTGCGGNTTATTCTTATGCTGATTTTTGGGGTAGTAAATTCAAAAGCATTCTA
GenBank Accession AL756684 [GenBank]
Graphic View Graphic view of gene At1g21500
Predicted Position of Insertion Chr1:7530446 - go to primer design
BLAST e Value 4e-155
Hit Clone Code (BAC ID) F24J8
Hit Gene Code At1g21500 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40