Sequences from confirmation amplicon


Confirmation sequences for line 112D10 and hit At2g20300 are shown.
Line ID 112D10
Locus At2g20300 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:8756282
Primers used for PCR DE04 - 8474, show primer details
   
Sequence Name 45-K019240-022-112-D10C-8409
GenBank Accession LN505373 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K019240-022-112-D10C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATCTACATGTAATGAGTATGAATCTA
CATCATCCTCGCAAAAACAAACAATTAAATCTCTATTGAGGATAATCATAACAACAAACA
GCTCCTAAAAGAAATCAAACCGGAAATCTTTACCCAGATGAACCGAACCTGGCCGGATTA
ACCAGAACCTAACCATGCAGCTCAAGAGTTTGTGAGCCTCCTTTTCCCTTTTCTTCACTG
TACATTTTCTGGTTTCTCAGAGCCAGTCACCATTGCCGGACCAGAGATGTCTAGACGACG
ACGGTCCACCGTGTTCGCTCATGCTTCCTCTCAGTCTAAAGAAGTTTCTTCTACTACGCA
TGGGTCTTAACGGACCTGATCTGTTTGGTAGAATAAGACCTCCTACTCTTGGAATGCTAG
AGGCAGAGTGAGGCCGGTTCTCCATGTCCTCTAGTGGTCCTGAGCTATAATCCATTGTTA
TGAACGACGAAGCTTGACCATACCTTAACCGAGGTGTCAAATTCCACCAGCTGCTATCCG
AAGGAGCCAGATCGCCTTTGAAGTCAGC
   
Sequence Name 46-K019240-022-112-D10C-DE04
GenBank Accession LN505722 [GenBank]
Sequencing primer gene specific primer, DE04: 5'-GTACCAGACTCTGCTGACTTCAAA-3'
Sequence (A. th genome BLAST matches underlined)
>46-K019240-022-112-D10C-DE04
GGCGATCTGGCTCCTTCGGATAGCAGCTGGTGGAATTTGACACCTCGGTTAAGGTATGGT
CAAGCTTCGTCGTTCATAACAATGGATTATAGCTCAGGACCACTAGAGGACATGGAGAAC
CGGCCTCACTCTGCCTCTAGCATTCCAAGAGTAGGAGGTCTTATTCTACCAAACAGATCA
GGTCCGTTAAGACCCATGCGTAGTAGAAGAAACTTCTTTAGACTGAGAGGAAGCATGAGC
GAACACGGTGGACCGTCGTCGTCTAGACATCTCTGGTCCGGCAATGGTGACTGGCTCTGA
GAAACCAGAAAATGTACAGTGAAGAAAAGGGAAAAGGAGGCTCACAAACTCTTGAGCTGC
ATGGTTAGGTTCTGGTTAATCCGGCCAGGTTCGGTTCATCTGGGTAAAGATTTCCGGTTT
GATTTCTTTTAGGAGCTGTTTGTTGTTATGATTATCCTCAATAAAGATTTAATTGTTTGT
TTTTGCGAGGATGATGTAAATTCATACTCATTACATGTAGATTCAATTGTAAATGGCTTC
ATGTCCGGGAAATC

Last Updated on 07.07.2016 14:16