SimpleSearch - Line and FST details


Line specific information

 
Line ID 112D10
Vector Used pAC161
Line Availability only available from NASC (N410702)
Segregation Analysis 175:152:129
Confirmed for Hit At2g20300
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g20300

 
Sequence (A. th genome BLAST matches underlined)
>76-K014767-022-112-D10-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATCTACATGTAATGA
GTATGAATCTACATCATCCTCGCAAAACCAACAATTAAATCTCTATTGAGGATAATCATA
ACAACAAACAGCTCCTAAAAGAAATCAAACCGGAAATCTTTACCCAGATGAACCGAACCT
GGCCGGATTAACCAGAACCTAACCATGCAGCTCAAGAGTTTGTGAGCCTCCTTTTCCCTT
TTCTTCACTGTACATTTTCTGGTTTCTCAGAGCCAGTCACCATTGCCGGACCAGAGATGC
CTATGGGATCCTC
GenBank Accession CR356270 [GenBank]
Graphic View Graphic view of gene At2g20300
Predicted Position of Insertion Chr2:8756266 - go to primer design
BLAST e Value 2e-117
Hit Clone Code (BAC ID) F11A3
Hit Gene Code At2g20300 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23