Sequences from confirmation amplicon


Confirmation sequences for line 114D09 and hit At2g35940 are shown.
Line ID 114D09
Locus At2g35940 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15091696
Primers used for PCR JU08 - 8474, show primer details
   
Sequence Name 52-K020068-022-114-D09C-8409
GenBank Accession LN507677 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>52-K020068-022-114-D09C-8409
TAGATTTCCCGGACATGAAGCCATTTCTCATCCATCTATGTATAATTAGTAGTTGTTACA
CACGAATGAAACGACGTCGTTTTCTTTGATTCTCTTTCAATTCTTGACCTTCTTTCACCA
AGCTGATTGATATCATAGAAAAACAAACAAAAGTATGAAAAAGGAGCAAAAACAAAACCA
CTATAAGTTTAATATAGATCTGTATATATATACAGTTGAAGCGAAGAAAAAAAGAATCGT
GATCACATCAAGAAGACGAAGAAGAAGGGATGAATTATGGATTATGAGAAAGAGAGATTG
AAGGATATGGAAATTAAGACATAATCATGATTGAAAATAAAATAATAAAATAATAGAGTT
AGAAATTGAAAGAAAAAATGAATATTATAAAAGATGAAGAACCTGGATTGATAGAGATCT
GAGGATGCACGTGTTTCATGATCATCTCAAGCTGCAAAAGGAAAGTTACATTAGAGAATT
TCTATCAAAGAGAAAGAAGAGAGACGACCACACACATACACACGAATATACACTTATATA
TATATATTTATATGCATACCTGTGTTTGTGGAGATGTGTGTGATTGCTATGTGAGTTTGG
TCTCTGTGTCAGACTCAAAGATCTCTGCAA
   
Sequence Name 51-K020068-022-114-D09C-JU08
GenBank Accession LN507359 [GenBank]
Sequencing primer gene specific primer, JU08: 5'-GAGCAAGAAAAGAGTTGCAGAGAT-3'
Sequence (A. th genome BLAST matches underlined)
>51-K020068-022-114-D09C-JU08
TTTGAGTCTGACACAGAGACCAAACTCACATAGCAATCACACACATCTCCACAAACACAG
GTATGCATATAAATATATATATATAAGTGTATATTCGTGTGTATGTGTGTGTGTCTGTCT
CTCTCTCTTTCTCTTTGATAGAAATTCTCTAATGTAACTTTCCTTTTGCAGCTTGAGATG
ATCATGAAACACGTGCATCCTCAGATCTCTATCAATCCAGGTTCTTCATCTTTTATAATA
TTCATTTTTTCTTTCAATTTCTAACTCTATTATTTTATTATTTTATTTTCAATCATGATT
ATGTCTTAATTTCCATATCCTTCAATCTCTCTTTCTCATAATCCATAATTCATCCCTTCT
TCTTCGTCTTCTTGATGTGATCACGATTCTTTTTTTCTTCGCTTCAACTGTATATATATA
CAGATCTATATTAAACTTATAGTGGTTTTGTTTTTGCTCCTTTTTCATACTTTTGTTTGT
TTTTCTATGATATCAATCAGCTTGGTGAAAGAAGTCAAGAATTGAAAGAGAATCAAAGAA
AACGACGTCGTTTCATTCGTGTGTAACAACTACTAATTATACATAGATGGATGAGAAATG
GCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAANTTATGGAGA
AA

Last Updated on 07.07.2016 14:16