Sequences from confirmation amplicon


Confirmation sequences for line 116D05 and hit At1g74230 are shown.
Line ID 116D05
Locus At1g74230 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:27915149
Primers used for PCR JG02 - 8474, show primer details
   
Sequence Name 31-K022409-022-116-D05C-8409
GenBank Accession LN499982 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K022409-022-116-D05C-8409
AGATTTCCCGGACATGAAGCCATTTACTCAATTGAATATTAAATTCTCCAATCGAAAGAA
TGTTTTTTTCTTGCTTTTATTGACGATTGAATTGATGGGTCTTACGCGTGTGTATTCATG
AGTTTCATCTTCTGTAACTACCTTTTTCTGAAAGCACTATCTATGTTTTGGTATGTCCTT
AATTTGCCTAACCACCACGTGATTGCTCATTTGCTCTTTCATTTGAATCTAGAATACGGA
TATACTCCAAATGGCTTTCTTAAGTAAAGTTGGAAGGTTATTCAGTCAGACCAGCAGCCA
TGTCACTGCCTCTAGCTCGATGCTACAGAGCATCCGTTGCATGTCTTCATCAAAAATCTT
TGTTGGAGGTGACTATGACTCTAATTCAGCTGTGCGAGAGAATACTCTCTTTTGTTTTGT
TTGTCTCAAAAATTGTCTATGTTTCTTCAGGTATCTCCTACAGCACTGATGAGTTTGGCT
TAAGAGAAGCTTTTAGCAAATATGGAGAAGTTGTTGATGGTAACTAGCTTTCTCCCTTTA
AGTTATTGCACAAAACTCTAACCTTTGAAGTATTAAATTCCTTTTGCTATATTTTTGTGG
TTTTACTCTTAACAACTGACTAATTTTTATCAATTGCAGCAAAGATTATTG
   
Sequence Name 32-K022409-022-116-D05C-JG02
GenBank Accession LN500409 [GenBank]
Sequencing primer gene specific primer, JG02: 5'-GTTTCACGGTCCACAATAATCTTT-3'
Sequence (A. th genome BLAST matches underlined)
>32-K022409-022-116-D05C-JG02
CAATTGATAAAAATTAGTCAGTTGTTAAGAGTAAAACCACAAAAATATAGCAAAAGGAAT
TTAATACTTCAAAGGTTAGAGTTTTGTGCAATAACTTAAAGGGAGAAAGCTAGTTACCAT
CAACAACTTCTCCATATTTGCTAAAAGCTTCTCTTAAGCCAAACTCATCAGTGCTGTAGG
AGATACCTGAAGAAACATAGACAATTTTTGAGACAAACAAAACAAAAGAGAGTATTCTCT
CGCACAGCTGAATTAGAGTCATAGTCACCTCCAACAAAGATTTTTGATGAAGACATGCAA
CGGATGCTCTGTAGCATCGAGCTAGAGGCAGTGACATGGCTGCTGGTCTGACTGAATAAC
CTTCCAACTTTACTTAAGAAAGCCATTTGGAGTATATCCGTATTCTAGATTCAAATGAAA
GAGCAAATGAGCAATCACGTGGTGGTTAGGCAAATTAAGGACATACCAAAACATAGATAG
TGCTTTCAGAAAAAGGTAGTTACAGAAGATGAAACTCATGAATACACACGCGTAAGACCC
ATCAATTCAATCGTCAATAAAAGCAAGAAAAAAACATTCTTTCGATTGGAGAATTTAATA
TTCAATTGAGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGAT
GGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGA
TGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCG
TCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATT

Last Updated on 07.07.2016 14:16