SimpleSearch - Line and FST details


Line specific information

 
Line ID 116D05
Vector Used pAC161
Line Availability only available from NASC (N411081)
Segregation Analysis 100:91:68
Confirmed for Hit At1g74230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g74230

 
Sequence (A. th genome BLAST matches underlined)
>36-K012502-022-116-D05-8409
TTGATCCATGGTAGATTTCCCGGACCATGAAGCCTTTACTCAATTGAATATTAAATTCTC
CAATCGAAAGAATGTTTTTTTCTTGCTTTTATTGACGATTGAATTGATGGGTCTTACGCG
TGTGTATTCATGAGTTTCATCTTCTGTAACTACCTTTTTCTGAAAGCACTATCTATGTTT
TGGTATGTCCTTAATTTGCCTAACCACCACGTGATTGCTCATTTGCTCTTTCATTTGAAT
CTATGGGATCCTCCCTATAGTGAGTCGATTTTACTCATAAAGTTGGAAGGTTATTCAGTC
AGACCAGCAGCCATGTCACTGCCTCTATGGGATCCTCCCTATAGAGAGTCGGATTACTCA
CATCAAAAATCTTTGTTGGAGGTGACTATGACTCTAATTCAGCTGTGCGAGAGAATACTC
TCTTTTGTTTTGTTTGGCTCAAAAATTGACTATGTTTCTTCAGGTATCTCCCTACAGCAC
TGATGAGTTTGGCTTAAGAGAAGCTTTTACCAGATATGGAAAAAGTGTCGATGGCAACTA
GGTGTCCCCCTTTAA
GenBank Accession AL757014 [GenBank]
Graphic View Graphic view of gene At1g74230
Predicted Position of Insertion Chr1:27915142 - go to primer design
BLAST e Value 2e-86
Hit Clone Code (BAC ID) F1O17
Hit Gene Code At1g74230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glycine-rich RNA-binding protein 5
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40