Sequences from confirmation amplicon


Confirmation sequences for line 116E08 and hit At2g30620 are shown.
Line ID 116E08
Locus At2g30620 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:13045295
Primers used for PCR AJ01 - 8474, show primer details
   
Sequence Name 55-K021738-022-116-E08C-8409
GenBank Accession LN508674 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>55-K021738-022-116-E08C-8409
TGAGCCATTTACAATTGAATATATCCTGAGAGTAATTACATTTTCCGACGCATCATATTG
ACTATATTCTCCGACGCATTACATTTTCTTCCGATCAATACAGAGAGATCAGTTTCTGAG
AGAGAAGAAGATGTCTATAGAGGAAGAAAACGTTCCAACGACTGTTGACTCAGGAGCTGC
CGATACAACGGTGAAATCTCCGGAGAAGAAACCGGCGGCGAAAGGTGGTAAATCTAAGAA
GACGACGACGGCTAAAGCAACGAAGAAGCCTGTGAAAGCTGCTGCTCCAACGAAGAAGAA
AACAACTTCCTCTCACCCTACCTTGNAAGAGG
   
Sequence Name 56-K021738-022-116-E08C-AJ01
GenBank Accession LN508976 [GenBank]
Sequencing primer gene specific primer, AJ01: 5'-GACCTCTTCATAGGTAGGGTGAGA-3'
Sequence (A. th genome BLAST matches underlined)
>56-K021738-022-116-E08C-AJ01
CACAGCTTTCACAGGCTTCTTCGTTGCTTTGCCGTCGTCGTCTTCTTAGATTTACCACCT
TTCGCCGCCGGTTTCTTCTCCGGAGATTTCACCGTTGTATCGGCAGCTCCTGAGTCAACA
GTCGTTGGAACGTTTTCTTCCTCTATAGACATCTTCTTCTCTCTCAGAAACTGATCTCTC
TGTATTGATCGGAAGAAAATGTAATGCGTCGGAGAATATAGTCAATATGATGCGTCGGAA
AATGTAATTACTCTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACA
TGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTT
TTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGAT
AAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAA
TTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25