SimpleSearch - Line and FST details


Line specific information

 
Line ID 116E08
Vector Used pAC161
Line Availability only available from NASC (N411096)
Segregation Analysis 90:89:63
Confirmed for Hit At2g30620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g30620

 
Sequence (A. th genome BLAST matches underlined)
>61-K012502-022-116-E08-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGACCATCTTACTTGATT
ATAATCTCTTGTACTGACGCTTATTTTTGACTATGTGCTCCTAAGCACTGACTTGTCTTC
CGTTCTCTCATAGAGATAATGATCTGAACTAGAATAGGATGTCTATACTAGGATTAGAAC
TGTTCCACACGACTGATGACTCATGATCTGCCGATACAACGGAGGATTACCAGTGTAAGG
ATCGCGGCGGCTAATGGAGTGTGATCTAGTACTACGACGACTGGTAAAGCAGCGAATAAG
CCTGTGAAAGCTGCTGCTCCAACGAAGAAGAAAACAACTTGCTCTCACCCTACCTATGAA
GAGGTCAATATTCGATCTAAACTGTTTTTTTTTGAATTTTTATCAAATTCATAAATTTGG
AATTTGAATTTTGTTTGAATTCGAGGCAAATGATTAAAGATGCGATGGTACCGTTGAAGG
AAAAAACTGGATCTATGGGATCCTCCCTATAGGGAGTCGT
GenBank Accession AL757023 [GenBank]
Graphic View Graphic view of gene At2g30620
Predicted Position of Insertion Chr2:13045256 - go to primer design
BLAST e Value 2e-43
Hit Clone Code (BAC ID) T6B20
Hit Gene Code At2g30620 [TAIR] [MIPS] [SIGnAL]
Gene Annotation winged-helix DNA-binding transcription factor family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23