Sequences from confirmation amplicon


Confirmation sequences for line 120D03 and hit At5g11300 are shown.
Line ID 120D03
Locus At5g11300 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:3602364
Primers used for PCR AS03 - 8474, show primer details
   
Sequence Name 12-K018322-022-120-D03C-AS03
GenBank Accession LN491362 [GenBank]
Sequencing primer gene specific primer, AS03: 5'-CGCCACACAATAGCTACAGAATTA-3'
Sequence (A. th genome BLAST matches underlined)
>12-K018322-022-120-D03C-AS03
AGAGACGACATAACATCCAATGTCTGAAAATAGGTATTTTGATCACCTGACTTGGGCTCT
GTTTTCGATGTTGCTTGGTGTCATCTTGAGAATAGTGATGTGACTCGTTTGGGAGATGTC
AGCTTTGCCACGCTCTTAAACTATCAAAGTCATACAGAATTAAAACCAGTTCAATCATTC
ATTCACTTTTCTTCAACAATCAGTAGTTTGATTTAACGGTGTTTTGTAGAGAAATGTACC
TTTGGTTGGTTGTATTTCTCAC
   
Sequence Name 16-K018322-022-120-D03C-8409
GenBank Accession LN493224 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K018322-022-120-D03C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCATTTACAATTGAATATAGT
TTCCTAAGGTTCCTGCCATCACTAATTGCTGCTTCAGCTGTTTTCCTAGCCCGATGGACA
CTCGACCAAACTGACCATCCTTGGGTCAGCTCATGTTTCTTGAATCTTGAAAAAGGTTGT
TTTTGTGTTTGCCTCTTTTTTGTGCTGATAAAAAGAATGATGTTTGGTTATAGAACCCTA
CTCTGCAACACTACACCAGATATGAGGTAGCTGAGCTGAAGAACACAGTTCTCGCCATGG
AGGACTTGCAGCTCAACACCAGTGGCTGTACTCTCGCTGCCACCCGTGAGAAATACAACC
AACCAAAGGTACATTTCTCTACAAAACACCGTTAAATCAAACTACTGATTGTTGAAGAAA
AGTGAATGAATGATTGAACTGGTTTTAATTCTGTATGACTTTGATAGTTTAAGAGCGTGG
CAAAGCTGACATCTCCCAAACGAGTCACATCACTATTCTCAAGATGACACCAAGCAACAT
CGAAAACAGAGCCCAAGTCAGGTGATCAAAATACCTATTTTCAGACATTGGATGTTATGT
CGTCTCTTTGCCAGTTTTGTCTGTCTGTAATTCTGT
Primers used for PCR 42ws - 3144, show primer details
   
Sequence Name 37-K118610-0022-120-D03C-42ws
GenBank Accession LN502791 [GenBank]
Sequencing primer gene specific primer, 42ws: 5'-GCTTCGTAAGTCCCTACTTTGTTG-3'
Sequence (A. th genome BLAST matches underlined)
>37-K118610-0022-120-D03C-42ws
GCATGAGAACAGCATTTCCATCACTGGGAGAGCGCGAACCTATATATATATGTATACTTG
CTAAGTAGAGAAACAAGTAAGGCTTATCTTCCTTATACATTTTTGTTGAACCTTGTAGAA
AATATGAAGAGCTTTCCGCACCAGGGGTGGAGGAGTTTTGCTTCATTACGGCCAACACAT
ACACAAGACCAGAAGTAATTAACATTCAAATCACACATCTCTCGGTATCTTTAATGTGTA
CAGATTCTTGATGAAAATATATAAACTGGAATCTTTGTTTCAGGTGCTGAGCATGGAGAT
TCAAATTCTAAATTTTGTGCACTTTAGATTATCGGTTCCTACCACCAAAACATTTCTGAG
GTAAATACTAAAGGGCAGAACTATGAATCATCATATCTTTCCAACTTTGTTTAAAAATAG
TACCACTGAGTTTTCATCTTACCAATGTTTTTTCAGGCGGTTCATTAAAGCAGCTCAAGC
TTCGTACAAGGTATGAAACCATGATCCATTTATCATCAACCCTCACTTCTACAGAAACTT
GGAATCTGAATGTAGTGCGTTGTAGTGAATGCATGCATGTCGACTCTAGAGGATCCCCAA
TTCCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCG
AACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGG
TGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAA
GGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCC
CAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCC
ATCATTGCGATAAAGGAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGA
TGGACCCC
   
Sequence Name 01-K118609-0022-120-D03C-35St
GenBank Accession LN486789 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K118609-0022-120-D03C-35St
TTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCG
GGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAACTATCAGTGTTTATCAATTGTCGTGG
GTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCTTTCCTT
TATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAAGT
GACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATTACCCTTTGTTGAAAAG
TCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTAGACAAGCG
TGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCGTAAGAGACTCT
GTATGAACTGTTCGCCAGTCTTTACGGCGAGTTCTGTTAGGTCCTCTATTTGAATCTTTG
ACTCCATGGGAATTGGGGATCCTCTAGAGTCGACATGCATGCATTCACTACAACGCACTA
CATTCAGATTCCAAGTTTCTGTAGAAGTGAGGGTTGATGATAAATGGATCATGGTTTCAT
ACCTTGTACGAAGCTTGAGCTGCTTTAATGAACCGCCTGAAAAAACATTGGTAAGATGAA
AACTCAGTGGTACTATTTTTAAACAAAGTTGGAAAGATATGATGATTCATAGTTCTGCCC
TTTAGTATTTACCTCAGAAATGTTTTGGTGGTAGGAACCGATAATCTAAAGTGCACAAAA
TTTAGAATTTGAATCTCCATGCTCAGCACCTGAAACAAAGATTCCAGTTTATATATTTTC
ATNCAGAATCTGTACACATTAAAGATACCGAGAGATGTGTGATTTGAATGTTAATTACTT
CTGGTCTTGTGTATGTGTTGGCCGTAATGAAGCAAAA

Last Updated on 07.07.2016 14:16