SimpleSearch - Line and FST details


Line specific information

 
Line ID 120D03
Vector Used pAC161
Line Availability only available from NASC (N411463)
Segregation Analysis 100:100:80
Confirmed for Hit At5g11300
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g11300

 
Sequence (A. th genome BLAST matches underlined)
>01-K118609-0022-120-D03C-35St
TTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCG
GGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAACTATCAGTGTTTATCAATTGTCGTGG
GTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCTTTCCTT
TATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAAGT
GACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATTACCCTTTGTTGAAAAG
TCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTAGACAAGCG
TGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCGTAAGAGACTCT
GTATGAACTGTTCGCCAGTCTTTACGGCGAGTTCTGTTAGGTCCTCTATTTGAATCTTTG
ACTCCATGGGAATTGGGGATCCTCTAGAGTCGACATGCATGCATTCACTACAACGCACTA
CATTCAGATTCCAAGTTTCTGTAGAAGTGAGGGTTGATGATAAATGGATCATGGTTTCAT
ACCTTGTACGAAGCTTGAGCTGCTTTAATGAACCGCCTGAAAAAACATTGGTAAGATGAA
AACTCAGTGGTACTATTTTTAAACAAAGTTGGAAAGATATGATGATTCATAGTTCTGCCC
TTTAGTATTTACCTCAGAAATGTTTTGGTGGTAGGAACCGATAATCTAAAGTGCACAAAA
TTTAGAATTTGAATCTCCATGCTCAGCACCTGAAACAAAGATTCCAGTTTATATATTTTC
ATNCAGAATCTGTACACATTAAAGATACCGAGAGATGTGTGATTTGAATGTTAATTACTT
CTGGTCTTGTGTATGTGTTGGCCGTAATGAAGCAAAA
GenBank Accession HG968744 [GenBank]
Graphic View Graphic view of gene At5g11300
Predicted Position of Insertion Chr5:3602364 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitotic-like cyclin 3B from Arabidopsis
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890764 [GenBank]


Last Updated on 07.07.2016 14:03