Sequences from confirmation amplicon


Confirmation sequences for line 120D08 and hit At4g27370 are shown.
Line ID 120D08
Locus At4g27370 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:13698906
Primers used for PCR AS17 - 8474, show primer details
   
Sequence Name 32-K024727-022-120-D08C-8409
GenBank Accession LN500424 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>32-K024727-022-120-D08C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGCTAATTCATGGGCTAA
TTAGTAGTCTCTTTGGACCAGTCAAGAGTGGCTCAGCTGTGCAATGGCGAGAGATGCTAC
CATATCTTTTATCAATTGTGTGCAGGAGCTTCACCAATTCTTAAAGGTAACATTTTAAAC
CGAAATATCTATGAACTAATGCAGGAATTCAATCTTTCAGCTACATATGAGATTCTTTGG
AAGTATCCCTGCTGAAGCAAAGTGTAGACATATATAATTTACTGATTAGCTTACTTGCTC
AAGGCTAAGAGTAGCTAGAAGCTGCTAGTGCTAGACCATTTATTATATAATTTTGTTTGC
AGAGAGATTGAAGATTAAAGCAGCAAGTGAATACAATTATTTGAACCAGAGCAATTGCTT
AACCATTGATCGCACTGATGATGCTCAGAAATTTCACAAACTGATGGTACTTTTTTGTAT
TTCCAGTGCCTCCCTCTGTTTTCCGTGGAACATATGCTAGAGTTTTTTAATTTCATATTT
TATAAAAGATTTCCCTGTTGTTA
   
Sequence Name 33-K024727-022-120-D08C-AS17
GenBank Accession LN500842 [GenBank]
Sequencing primer gene specific primer, AS17: 5'-GAAAGCTTCCTATAACAACAGGGA-3'
Sequence (A. th genome BLAST matches underlined)
>33-K024727-022-120-D08C-as17
GATCAATGGTTAATACAATTGCTCTGGTTCAAATAATTGTATTCACTTGCTGCTTTAATC
TTCAATCTCTCTGCAAACAAAATTATATAATAAATGGTCAATCACTAGCAACTTCTATCT
ACTCTTACCCTTGAGCAAGTCAGCTAATCAGTAAATTATATATGTCTACCCTTTGCTTCA
GCAGGTATACTTCCAAAGAATCTCATATGTAGCTGTAAACATTGAATT

Last Updated on 23.10.2014 13:25