SimpleSearch - Line and FST details


Line specific information

 
Line ID 120D08
Vector Used pAC161
Line Availability only available from NASC (N411468)
Segregation Analysis 50:35:33
Confirmed for Hit At4g27370
Parent of DUPLO pair none
Parent of pair(s) 3602, 3623, 3672

Gene hit F9L1

 
Sequence (A. th genome BLAST matches underlined)
>60-K012823-022-120-D08-35St
TTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGAAGACCCTTCCTCTATATAAGG
AAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTT
CGGTTTAAACTATCAGTGTTTGATGACAACATGCATGTACAAGTTAAAAAGTAAAAGGAC
AAAAAAAATAAAAATTAAAAGGTGGTCCATGTACATGTATATTGTGTAATTAGTAGAATG
TTTTGTACACATATCTATGGGATCCTCCCTATAGAGAGTAGTATTACTCAGACGGGTTAT
AAAAAGAAAGTACTTTATCATAAGACCACTAATTACAATCCTCTATATCGATAAGAGAAA
ACAGTATACAAATTATTCTAATAAAGGAATATTCATGTTAACATGTGTACATTCACCTCC
AATTGGGGGCTTAGATGAGAGATCTACAATTGATGCCTAGATTTCACATTAACAGATACC
CATTACATCTTGAGATTGATCCGAGATTATGCTAAAATATGCTCTCATGTACATAACTAC
TGACAGCTATAGCTTCCAATACGACGTAGCCTATTACCTTACATAACTCCACTTATAAGC
TATGGGATCCTACATATATGGAATCCTCTCCACATATGAGCCGATTTCCTTAGACCCNTT
TTTTTTCCGGATTAAAGCCGGGTGGGCTCATCTCTGGGATTATAAAGCGGCCCCAGTATC
CAGAAAACCCTTAAACGGCGCCTGACCTTTACATTATTTCGCAATATACTTAATAGAGCC
TTAAATTGGCTCTTATCCGCGTTTAAAACTTTGGTGTCCCAGAACTCAAAATTCCAGAAT
AAAATGAGCCAAATTTTGATAACACATACGGGTGCTTAAAACTCTATCTATATCAGTATT
CCCCCAAAAGGCACCTGGGAAAACATATTAAGCAACAGCCAACAAACTTTGGTGCTTTAC
CAAAGAGAGAGA
GenBank Accession AL757284 [GenBank]
Graphic View Graphic view of sequence AL757284 of line 120D08
Predicted Position of Insertion Chr1:5282723 - go to primer design
BLAST e Value 2e-21
Hit Clone Code (BAC ID) F9L1
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g27370

 
Sequence (A. th genome BLAST matches underlined)
>60-K012516-022-120-D08-8409
TTGATCCATGTAGATTTCCCGGACATGAAGCTCTTTAAAACTGAAAAATCTCGAGGCTAA
TGTACTGACCTCCTTAGAGGGCTCTTTGGACCAGTCAAGAGTGGCTCAGCTGTGCAATGG
CGAGAGATGCTACCATATCTTTTATCAATTGTGTGCAGGAGCTTCACCAATTCTTAAAGG
TAACATTTTAAACCGAAATATCTATGAACTAATGCAGGAATTCAATCTTTCAGCTACATA
TGAGATTCTTTGGAAGTATCCCTGCTGAAGCAAAGTGTAGACATATATAATTTACTGATT
AGCTTACTTGCTCAAGGCTAAGAGTAGCTATGGGATCCTCCCTATAGTGAGTCGTGTNAC
TCAANNNGNAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAAGTGACAGATAGCTG
GGCAATGGAATCCGAGGAGGTTTCCGGATATTACCCTTTGTTGAAAAGTCTCAATTGCCC
TTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTAAACAAGCGTGTCGTGCTCCA
CCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCGGAAGAGACTCTGTATGAACTGTT
CGCCAGTCTTTACCGCGAGTTCTGGTAGGGCCCCTATTTGAATCTTTGACTCCATGGGAA
TTGGGGATCCTCTA
GenBank Accession AL757283 [GenBank]
Graphic View Graphic view of gene At4g27370
Predicted Position of Insertion Chr4:13698908 - go to primer design
BLAST e Value 2e-138
Hit Clone Code (BAC ID) M4I22
Hit Gene Code At4g27370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03