Sequences from confirmation amplicon


Confirmation sequences for line 123D02 and hit At1g74890 are shown.
Line ID 123D02
Locus At1g74890 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:28132935
Primers used for PCR DL29 - 8474, show primer details
   
Sequence Name 23-K018475-022-123-D02C-DL29
GenBank Accession LN496360 [GenBank]
Sequencing primer gene specific primer, DL29: 5'-AAACCAAACAAAAGAAAAGCAGAA-3'
Sequence (A. th genome BLAST matches underlined)
>23-K018475-022-123-D02C-DL29
TAAAGAGAAACAGTTTTGCCTTTTACCTTTACAAGCAGAGATCTTAAGCAATCTCTCAAT
AACTTTACGATCCACGAAACTATCATCAACGGCAAGAACATGTAACTCCGGTGAAGAAGA
AGAAGATAAAGAAGAAGATAAATCTCTGAGAGCCATTGTTTTCTCTCGGGAAAGTAAACA
ACAAAACAGATGAAGAAACGTTTAAAGTTTGAACGTCAAAGGACGCAGAAATCAATGTGA
AGAAGGAAGACGAGGAGTTACATAAATAAGAGAGAGAGAGAGAGAGAGGCAGAAGCGGTG
AGTGAGATACATAAATAAATAGGAAAGAGAAAGAGGAGGAGATTTAAGGAAATACACAGA
AGAGAATCTGGAGGATCGGATGTATAATGTAAAAATCTACGTGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTA
GATCTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATC
CGTCGTATTTATGGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCT
   
Sequence Name 24-K018475-022-123-D02C-8409
GenBank Accession LN496801 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>24-K018475-022-123-D02C-8409
CATGTAGATTTCTACATTATACATCCGATCCTCCAGATTCTCTTCTGTGTATTTCCTTAA
ATCTCCTCCTCTTTCTCTTTCCTATTTATTTATGTATCTCACTCACCGCTTCTGCCTCTC
TCTCTCTCTCTCTCTTATTTATGTAACTCCTCGTCTTCCTTCTTCACATTGATTTCTGCG
TCCTTTGACGTTCAAACTTTAAACGTTTCTTCATCTGTTTTGTTGTTTACTTTCCCGAGA
GAAAACAATGGCTCTCAGAGATTTATCTTCTTCTTTATCTTCTTCTTCTTCACCGGAGTT
ACATGTTCTTGCCGTTGATGATAGTTTCGTGGATCGTAAAGTTATTGAGAGATTGCTTAA
GATCTCTGCTTGTAAAGGTAAAAGGCAAAACTGTTTCTCTTTACGTTTTCTGCTTTTCTT
TTGTTTG

Last Updated on 23.10.2014 13:25