SimpleSearch - Line and FST details


Line specific information

 
Line ID 123D02
Vector Used pAC161
Line Availability only available from NASC (N411750)
Segregation Analysis 100:99:94
Confirmed for Hit At1g74890
Parent of DUPLO pair none
Parent of pair(s) 89634, 89636

Gene hit At1g74890

 
Sequence (A. th genome BLAST matches underlined)
>12-K012812-022-123-D02-8409
GATTCTCTTCTGCGCATTTCCTTATATCTCCTCCTCTTTCTCTTTCCTATTTATTTATGT
ATCTCACTCACCGCTTCTGCCTCTCTCTCTCTCTCTCTCTTATTTATGTATCTCCTCGTC
TTCCTTCTTCACATTGATTTCTGCGTCCTTAGACGCTCAAACTTTACACCTGCCTTCATC
TGTTGTGGCGTTTACTTTCCCGAGAAAAAACAGTGGCTCTCAGAGATATATATTCTTCTT
TATCTTCTTCTTCTCCACCGGAGTTACCTGTTCTTGCCGCTGATCGATAGAACCGTGGAT
CGTAGAGTTATTGAGAGATTGCATAAGATCTCTGCTTGTAAAGGCAAAAGGCAAAACTGT
GTCTCTCTACATCTTGTGCTTTTTTTTTGAGGGGTTACTGATCCTTTTTTTCGGATAAAT
TGGGTGGGCCTCTTTATACAGACACGACTGTTGAGAGCGGGACTATGGGACCCCCCTTAT
ACGGAAACTATCTACNCANCGGCCGCCTGAGACGTCTCTGACGGCGTCTGGACAACAATT
TCTGTTTCGGCCTCCTTCATTGCTTCCTGCTGAAATAATGAACAAAAATTACAATATTCG
AACCGGGAAATAAACTTATTGGATTATTCCCGCTCCTGAAACACCATAATACCCTGGTGG
GTTGGTAATCTGTTGAAATTTGGAGGCCTCTATGCCTGTTGCCCCTACAAGATTAACCCA
ATTTCTTTGNTGCC
GenBank Accession BX942872 [GenBank]
Graphic View Graphic view of gene At1g74890
Predicted Position of Insertion Chr1:28132922 - go to primer design
BLAST e Value 3e-103
Hit Clone Code (BAC ID) F25A4
Hit Gene Code At1g74890 [TAIR] [MIPS] [SIGnAL]
Gene Annotation response regulator 15
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23