Sequences from confirmation amplicon


Confirmation sequences for line 123D07 and hit At3g18030 are shown.
Line ID 123D07
Locus At3g18030 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:6168296
Primers used for PCR IY01 - 8474, show primer details
   
Sequence Name 11-K026692-022-123-D07C-8409
GenBank Accession LN490955 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K026692-022-123-D07C-8409
TTCCCGGACATGAAGCCATTTACAATTGAATATGCCTAAGGTGTTAGCAGACAAAGGAGC
AATGACTAAAACATCAGCCCAACGTCTAAGCTCGATGTGAAGGACAGGATCACCGATCTT
GTTCCAGCTAGACCATTCATCTTCATCAGTATACAGAGTCACTTCTTGTGGGAGAGAGAG
TTTATCGAGGAAATGTAGAGATGATTTCGTAACGACGGCTCTGACTTCTGCCCATTCGGT
GAAGCAATGGCAGAGATTGCCGAATTTGATAGCAGCGACGCTTCCACTTGCAGCGAGTAG
TACACGAGGCTTCCTCGGTGTGGTATTCACTTCCATGTCTTGTCTGTCTCTTTTCCCATT
CTCCATAGCTCTTTTACACCTTCAGAGATCTAGCAAAGTACCCGGTGGTTCGGAGAACAC
CCCTAACCGAAAAATTGATCTGGTCGAAGAGAATATCAAAATGTTTTAGAGGGAAGAGAA
AGAGAGAGGCCCGAGAGGACAATCATTTTAGT
   
Sequence Name 15-K026692-022-123-D07C-IY01
GenBank Accession LN492813 [GenBank]
Sequencing primer gene specific primer, IY01: 5'-AACAGTCGAACTCAGAATCGAAAT-3'
Sequence (A. th genome BLAST matches underlined)
>15-K026692-022-123-D07C-IY01
TGCAGTCCAAACGACGTAAATATAAAATGAAATATATCGATATTCACAGCCCATACGACC
GAGGCCTAAAAAAGAGTGAGTCAATGGCCCATTTGACCAGCAACTAAAATGATTGTCCTC
TCGGGCCTCTCTCTTTCTCTTCCCTCTAAAACATTTTGATATTCTCTTCGACCAGATCAA
TTTTTCGGTTAGGGTTCTTCGCCGAACCATTGGCTACTTTGCTAGATCTCTGAAGGTGTA
AAAGAGCTATGGAGAATGGGAAAAGAGACAGACAAGACATGGAAGTGAATACCACACCGA
GGAAGCCTCGTGTACTACTCGCTGCAAGTGGAAGCGTCGCTGCTATCAAATTCGGCAATC
TCTGCCATTGCTTCACCGAATGGGCAGAAGTCAGAGCCGTCGTTACGAAATCATCTCTAC
ATTTCCTCGATAAACTCTCTCTCCCACAAGAAGTGACTCTGTATACTGATGAAGATGAAT
GGTCTAGCTGGAACAAGATCGGTGATCCTGTCCTTCACATCGAGCTTAGACGTTGGGCTG
ATGTTTTAGTCATTGCTCCTTTGTCTGCTAACACCTTAGGCATATTCAATTGTAAATGGC
TTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAA
AGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGNTCGCAGCGTTATTA
TAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCGTCGTATTTATGGCGAAAG
CAATAAACAAATTATTCTAATTCGGA

Last Updated on 23.10.2014 13:25