SimpleSearch - Line and FST details


Line specific information

 
Line ID 123D07
Vector Used pAC161
Line Availability only available from NASC (N411755)
Segregation Analysis 50:30:19
Confirmed for Hit At3g18030
Parent of DUPLO pair 12232
Parent of pair(s) none

Gene hit At3g18030

 
Sequence (A. th genome BLAST matches underlined)
>52-K012812-022-123-D07-8409
AAATTGATCCATGTAGACTTTCCCTGGACATGAAGCCTTTACAATTGAATATGCCTAAGG
TGTTAGTCAGACAAAGGAGCAATGACTAAAACATCAGCCCAACGTCTAAGCTCGATGTGA
AGGACAGGATCACCGATCTTGTTCCAGCTATGGGATCCTCCCTATAGTGAGTCGTATTAC
TCAANNGGGGGACCGTGTCGTCTCCCTTAGGATCGTGGATATATCACATCAATCCACTTG
CTTTGAAGACGTGGCTGGAACGTTTTTTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCC
ATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCTTTCCTTTATCGCAACG
ATGGCATTTGAAGGAACCACCTTCCTTTTCCACTATCTTCACAATAAAGTGACAGATAGC
TGGGCATTGGAATCCGAGGAGGTCATCGGATATTACCCTAAGGTGAAAAGCCTCAATTGC
CCTATGGTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTAGACAAGCGTGTCGTGCTC
CACCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCGTAAGAGACTCTGTTTGAACTG
GTCGCCAGTCTTTACGGGGAGTTTTGTTAGGGCCCTTTATTTGAATTTTTGCCTCCATGG
GAATTGGGGAACCTCT
GenBank Accession AL764239 [GenBank]
Graphic View Graphic view of gene At3g18030
Predicted Position of Insertion Chr3:6168296 - go to primer design
BLAST e Value 4e-44
Hit Clone Code (BAC ID) MBG14
Hit Gene Code At3g18030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation HAL3-like protein A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23