Sequences from confirmation amplicon


Confirmation sequences for line 130E09 and hit At3g51960 are shown.
Line ID 130E09
Locus At3g51960 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:19284055
Primers used for PCR Z24a - 3144, show primer details
   
Sequence Name 39-K014709-022-130-E09C-3144
GenBank Accession LN503168 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>39-K014709-022-130-E09C-3144
TAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTC
ATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTT
AAACTATCAGTGTCAATTTACAATCTTTCTTTTTCTTTGATTCTCTGTAAGATTTTTCTT
TCTTGGGCCATGTCAAAAAATTATAAAGAGTTGACTACTGTTTTATTCATCCACTATGTT
AATCAAGAACATATTCTTCAACACCATCTTTACTTTAATCAAAAACCCTAATAATATCAC
CATAATTCTATGTCCCAAACAGAACAGGTGTTTTCTTTGGAGATCTTGAGTTTGGACCTC
AGAATCAAAGATATATAAAGATGAATGAGGAAGAAGATAAAGATCAAGATCGAGTAACGA
GAGGATGTAGTCACACTCATAGCTGTAACCCTCCAGGCCCAGAGGATGCTTCTCACTCCC
ACACATGCTTCCACGCTCACACTCATCTCATCATCTCTGTAATAATATCTCTTCCCTTAA
GATATGGTATGTTTCTGATGATATTTTAATGGATTGTTATAGATACATATTTTTATGTTG
CAGCAGGATCAGCAAGAGAATGATCATTCTGACAGTAGCAACAAGAAACGGTTATGTGGT
AATAGAGAGGCAGTGAGGAAGTACAGGGAGAAGAAGAAGGCTCGCACTGCATACCTTGAA
GATGAAGTGATGAGATTGCAATCTCTGAATGAGCAATTCCTTAGAAAA
   
Sequence Name 40-K014709-022-130-E09C-Z24a
GenBank Accession LN503532 [GenBank]
Sequencing primer gene specific primer, Z24a: 5'-TTGGAATCCGACCTCTATGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K014709-022-130-E09C-Z24a
CCCTATTAAACCATATGTATATATATACACACAATACCACAGCCCGTAAACGCTTAACGT
GAGAATGGTGGTGGTTGAGGAACAAAAGATTGAATAGGATCATGAAGTGTTTGGCCCTCC
TCGCACTCCACTCTTGCCGCTTCACACATCATATTACTTGTTGCTAAGTTGCATCCATCT
GTGTGATTACACGAGATCCAAAATTGTGTCAAGATTAGGTCTAGGTCACTTTTGTATAAA
AATGATGGTGATGAATGGTTTACTATTAGTTTACGTTTTCATTATTCGAAAATGTGATTT
TTACTAAGACGATAACCAAATAAATGAAACTAGTTCTTTAGCGTTTCGTATTGTTCAATA
AAATTTCAGTAGCTCAAATTTCATTAGCTATTTACTAGTTCTTCCTCTTAATGCTAAATT
TTTCATCAACGTATCAGATTGTTGACAACCAATTTCAACTAGTAAACCAAATAGTAGGAG
AAATCACCTTCTTTGAACACAAAACCAGAACCGTTGCATTGTTTCTGAAACGAGAAACTA
CAAAGTTCAACTTCAATTTTCCCCTGCATCTCTACCAGAAGAGCCCGGAGTCTGATCAAT
TCAGTTTCCACCATTTCTTGGCTCTGAAGTTTTCTAAGGAATTGCTCATTCAGAGATTGC
AATCTCATCACTTCATCTTCAAGGTATGCAGTGCGAGCCTTCTTCTTCTCCCTGTACTTC
CTCACTGCCTCTCTATTACCACATAACCGTTTCTTGTTGCTACTGTCAGAATGATCATTC
TCTTGCTGATCCTGCTGCAACATAAAAATATGTATCTATAACAATCCATTAAA
Primers used for PCR FL11 - 8474, show primer details
   
Sequence Name 53-K028352-022-130-E09C-8409
GenBank Accession LN508039 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K028352-022-130-E09C-8409
CATTACAATTGAATATATCCTGGTAAAACAAAACATCCAAGTACAAAGATTGATAGGCTT
TTTGGTTTTGAGATTACCTTAAAATGTTTTTTTTTTTGTCTGTACCAAACTTTGAAAGGG
TTTTATTACTAGAAATTACGACGGAACAATAAGCAAAGCCATTTACCATATCCCCAGACC
CCAATGAATAATATATTATAAGAAAGAGAATTGGTTCTTTAAGGTCAATTGTCAAATTGT
TTCGAATAGAAAAAGAAAAAAACTTTTCTCAGGGATTTTAACTTATGGCACGTCTCTATC
ATTATTAAGGGTTCGCGGGCGGACACGTTTTGAAAACGGGTTTATCATCATCATCTTGCT
TCCCGACAAGATTTGAGTTCAAAAAGCAAAAATGGCGAGTTTCATCAAGGCAGGGGGTTT
AGGGATCATCTCACTGGGTTACACTTTTTTCATTGCCAAATTGGTTCCAAAAGGAATCAA
AAGGCTCAAACTATTTTTCCC
   
Sequence Name 53-K028352-022-130-E09C-FL11
GenBank Accession LN508040 [GenBank]
Sequencing primer gene specific primer, FL11: 5'-AAAATGAGGAAGACAGGGAAAAAT-3'
Sequence (A. th genome BLAST matches underlined)
>53-K028352-022-130-E09C-FL11
GAAAACTCCGCCATTTTTGGCCTTCTGAAACTTCAAATCTCGTCGGGAAGCAAGATGATG
ATGATAAACACNGTTTACAAAACGTGTCCGCCAGCGAACACTAAATAATGATAGAGACGT
GCAATAAGTTAAAATCCATGAGAAAAGTCTTCTTCTTTTTCTATACGAAACAATTTGACA
ATTGACATTAAAGAACCAATTCTCTTTCTTATAATATATTATTCATTGGGGTCTGGGGAT
ATGGTAAATGGCTTTGCTTATTGTTCCGTCGTAATTTCTAGTAATAAAACCATTTCAAAG
TTTGGTACAGACAAAAAAAAAAACATTTTAAGGTAATCTCAAAACCAAAAAGCCTATCAA
TCTTTGTACTTGGATGTTTTGTTTTACAGGATATATTCAATTGTAAATGGCTTCATGTCC
GGGAAATCTACTTGGATCACCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTA
ATTACCAATTTTTTTTCAATTCAAAAATGTAAATGTCCCCACCGTTTTTATAAAATGAAA
GTACTTTTTGATAAAACGACAAATTACAATCCGTCGTATTTATGGGCAAAAGCAATAAAC
AAATTATTCTAATTCGAAAATCTTTATTT

Last Updated on 07.07.2016 14:16