SimpleSearch - Line and FST details


Line specific information

 
Line ID 130E09
Vector Used pAC161
Line Availability available as T3 set from NASC (N412441)
Segregation Analysis 100:95:68
Confirmed for Hit At3g51960
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g51960

 
Sequence (A. th genome BLAST matches underlined) 
>69-K012667-022-130-E09-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGTAAAA
CAAAACATCCAAGTACAAAGATTGATAGGCTTTTTGGTTTTGAGATTACCTTAAAATGTT
TTTTTTTTTGCCGGACCCAAACTTGAAAAGGGTTTAATATCCATATGGGAACCCCCCTTA
AAG
GenBank Accession AL764747 [GenBank]
Graphic View Graphic view of gene At3g51960
Predicted Position of Insertion Chr3:19284055 - go to primer design
BLAST e Value 1e-25
Hit Clone Code (BAC ID) F4F15
Hit Gene Code At3g51960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic leucine zipper 24
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL764747 [GenBank]


Last Updated on 10.06.2021 13:37