SimpleSearch - Line and FST details


Line specific information

 
Line ID 130E09
Vector Used pAC161
Line Availability only available from NASC (N412441)
Segregation Analysis 100:95:68
Confirmed for Hit At3g51960
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g51960

 
Sequence (A. th genome BLAST matches underlined)
>69-K012957-022-130-E09-35St
TTGCGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAAATTGTCGTTTCCCGCCTTCG
GTGCTAAACTATCACTGTCAATTTACAATCTTTCTTTTTCTTTGATTCTCTGTAAGATTT
TTCTTTCTTGGGCCATGTCAAAAAATTACTAAGAGTGGACTACTGCCTTATTCATCCACT
ATGTAAATCAAGAACATATTCTTCAACACCATCTTTACTTTAATCGAAAACCCTAATAAT
ATCACCATAACCTCTATGTCCCAAACAGAACACGTGTTCTCTTTGGAGATCTTGAGTTTG
GACCTCAGAATCAAAGATATATAAAGATGAATGAGGAAGAAGATAAAGATCAAGATCCAG
TAACGAGAGGATGTAGTCACACTCATAGATGCAACCCTCCAGGCCCAAGAGATGCTTCTC
ACTCCCACACATGCTTCCACGCTCACACTCATCTGATCATCTCTGTAATAATATCTCTTA
CCTTAAGATATGGTATGATTCAGATGATATCTTAAGTGCATCGTTATAGATACATATTGT
TATTGCTGCAGCCAGGATCAGCCAAGAGAATGATCATTTCTGACAGTAGCAACAAGAAAC
GGGTTATGTGGGTAATAGAGAGGCAGTGAGGAA
GenBank Accession AL764748 [GenBank]
Graphic View Graphic view of gene At3g51960
Predicted Position of Insertion Chr3:19284021 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4F15
Hit Gene Code At3g51960 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic leucine zipper 24
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23