Sequences from confirmation amplicon


Confirmation sequences for line 130F03 and hit At2g27900 are shown.
Line ID 130F03
Locus At2g27900 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:11878173
Primers used for PCR BG17 - 8474, show primer details
   
Sequence Name 80-K101672-0022-130-F03C-8409
GenBank Accession LN513928 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>80-K101672-0022-130-F03C-8409
TCGGACTGAGCCATTTACATTGAATATATCCCTCAATTGTGTATGCTTTGTTTTCGTGTT
TGTGATATCATTACTAAGCCCACAGGTGACATTTTGGTTTTGTTGTTGTGTAGGATTTTG
ATCCGGTAAGGCATATTTTGGAGAATGTGCCGGATGATGAAAGTGAGTTAGCTTATTTTG
AGAAGCAGGTACTAACTTTTAACTTCTCTCAAGGAATTGAATATAAACTGATGCGTCTAT
TGTGAAAGGTTAAGAATGTTGATGAACGTTTTAGTTAGTGAGTTTAATAGGTTTTGTTTA
CTGTGTAGGCTACCTTGAGGTTGGTACAGCTGGATAAAGTGGCAGAAACTCTGTCTCACC
ATGTTATGGAGCATCATGAAGTAATGGGTAAGTATTCTTGAATTGAGAAGATCATATGCG
TTTGGTTTTGTGAGTATTAATATTTGCTTTTGGCCAGTGAAGGGGATGAATTTGGTAAGA
GAATTGGAGAAAGATTTGAAGATTGCAAATGTCATCTGCAAGGTATGAGTTTCATATTCT
TAACCTAAATTTTACATAAACAATACAGTGGTTTTATTTTCTATTTTATCTATNACTGGT
TTGACTGGTTTT
   
Sequence Name 80-K101679-0022-130-F03C-BG17
GenBank Accession LN513929 [GenBank]
Sequencing primer gene specific primer, BG17: 5'-CCAAAACCAAGTCAAACCAGTAAT-3'
Sequence (A. th genome BLAST matches underlined)
>80-K101679-0022-130-F03C-BG17
TATTGTTATGTAAAATTTAGGTTAAGAATATGAAACTCATACCTTGCACATTACATTTGC
AATCTTCAAATCTTTCTCCAATTCTCTTACCAAATTCATCCCCTTCACTGGCCAAAAGCA
AATATTAATACTCACAAAACCAAACGCATATGATCTTCTCAATTCAAGAATACTTACCCA
TTACTTCATGATGCTCCATAACATGGTGAGACAGAGTTTCTGCCACTTTATCCAGCTGTA
CCAACCTCAAGGTAGCCTACACAGTAAACAAAACCTATTAAACTCACTAACTAAAACGTT
CATCAACATTCTTAACCTTTCACAATAGACGCATCAGTTTATATTCAATTCCTTGAGAGA
AGTTAAAAGTTAGTACCTGCTTCTCAAAATAAGCTAACTCACTTTCATCATCCGGCACAT
TCTCCAAAATATGCCTTACCGGATCAAAATCCTACACAACAACAAAACCAAAATGTCACC
TGTGGGCTTAGTAATGATATCACAAACACCAAAACAAAGCATACACAATTGAGGGATATA
TTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGG
TCAATATGGAGAANAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATG
TCCGCA

Last Updated on 23.10.2014 13:25